| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAGCUGCCAGCCAGAGAGGGAGUCAUUUCAUUGGCGUUUGAGUCAGCAA… | 2017 nt | 0.3867 | |
| UUGUUUUUCUCUUUGGCUGUUUUCUCUCACAUUGCCUUCUCUAAAGCUA… | 2052 nt | 0.3855 |
The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is a pleiotropic cytokine involved in various immune responses, inflammatory processes, and hematopoiesis. This cytokine is produced by monocytes and macrophages as a proprotein, which is proteolytically processed and released in response to cell injury, and thus induces apoptosis. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. It has been suggested that the polymorphism of these genes is associated with rheumatoid arthritis and Alzheimer's disease. [provided by RefSeq, Jul 2008]
A study in porcine skin demonstrated that the IL1A was down-regulated at 1.5, 3, and 6 hours but up-regulated at 24 hours following chlorine vapor exposure, identifying it as a common potential therapeutic target shared among three significantly altered signaling pathways [Price et al. DOI:10.3109/15569527.2012.679374]. In human skin, analysis of thermally injured tissue showed the IL1A was significantly up-regulated in burned tissue across early, middle, and late temporal periods post-injury [Greco et al. DOI:10.1016/j.burns.2009.06.211]. A study in human skin wounds demonstrated that a ratio of IL-1a-positive cells exceeding 30% indicates a wound age ranging from 4 hours to 1 day [Kondo et al. DOI:10.1016/J.Forsciint.2010.07.004]. In a rat model of contusive spinal cord injury, IL-1a gene expression was found to be increased in the injury epicenter at 3 hours post-injury [Aimone et al. DOI:10.1016/j.expneurol.2004.05.042].