Basic Information

Symbol
IL1A
RNA class
mRNA
Alias
Interleukin 1 Alpha IL1F1 Hematopoietin-1 IL1-ALPHA IL-1A Pro-Interleukin-1-Alpha Preinterleukin 1 Alpha Interleukin-1 Alpha IL-1 Alpha IL1
Location (GRCh38)
Forensic tag(s)
Wound age identification Mechanical injury analysis

MANE select

Transcript ID
NM_000575.5
Sequence length
2017.0 nt
GC content
0.3867

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-501.20 kcal/mol
Thermodynamic ensemble
Free energy: -542.90 kcal/mol
Frequency: 0.0000
Diversity: 471.23
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((.....((((((((((((((((((..(((((((((((....((((((.(((((((((((((.....(((((....(((((((.....((.((((((((.................)))))))).))......(((.((((((((...((((((..((((((....(((..(((((.(((..((((.((((((..((.(((((......(.((.((.(((...))).)).))..)......))))).))...)))))).)))).....))).))))).))).......))))))))))))...)))))))).))).))))))).....(((((....)))))..)))))))))))).......((((((((((.((((((((.(((((((((((.....(((((.((((...))))..((((...))))(((((.(((((.((((((...............)).))))...)))))...)))))........(((((..(.((((((.(((...((((((.((((.((.....)))))).))))))..((..(((....((((((.......((((....))))((((.(((((....(((.((((..((((......(((...(((((((((.(((((.((((.(((.(((...((((((...(((((((((.((((((((...((((..(((......)))((.(((......))))).......))))...)))).))))))..(((....)))...(((((.((.((((((..(((((((.........))))))).....)))))).))..((.((((((....)))))).)))))))))))))).))))))....((((((....))))))..........)))))))))).)))))(((((((((((.(((((((...)))))))..)).............)))))))).)....(((.((......)).)))......((((.....))))((((.(((((((...)))))))))))........)))))))))...)))))))..))))))).....)))))))))))))))..)))..)).........(((((.(((.....))).)))))...))).)))))))..)))))...............(((((.......))))).........(((((..............))))).((((....)))).....))))).....)))))))).))).))))))))(((((...(((((((((((...........(((((.(((........)))..))))).............((((.(((((.........))))).))))......((((...(((((((((..(((...........)))....)))))))))......)))).......((((((.((...)).)))))).)))))).))))).))))).......(((((.(((.(((((((........)))))))))).)))))((((.((((......)))).))))(((...)))....))))))))))((((.((((....((((.(((..((((((((.(((((((((((((((((.(((((((...))))).)).((((......))))......))))))))))......))))))).)))...))).))..))))))).))))...)))).......................(((.((((.....)))).)))...)))))).))))))..))))))......((((....((((.............))))....)))).....)))))....))))).))))...(((((.(((..((....))..))).))))).....)))))))))((((((((....((((..((..((((.....))))..))..))))......)))))))).............(((((((((((....)))))))))))..........))))).........
Thermodynamic Ensemble Prediction
{{(((,,.,,((((((((((((((((((..(((((((((((....((((((.(((((((((((((.....(((((....{{{{{,..,,..{{.((((((((....{............)))))))).}}......(((.((((((((...((((((..((((((....{((..(((((.((({.((((.((((((..((.(((((......{.((.((.(((...))).)).))..,......))))).))...)))))).)))).....))).))))).)),.......))))))))))))...)))))))).))).,}},}}}.....(((({....)))))..)))))))))))).......((((((((((.((((((((.(((((((((((.{,..{{{{{.((((,.,|}}}..{{(({{.{|..{((({.(((((.(((({,....,,,,,,.....|||,|||...}}))).,,)}})}..,,}}}}((((,,|{.((((((.(((...((((((.((((.{{.....}})))).))))))..,,..{{{..,,(((({{.....{(((((....)))))|{{.{{{{{....({(,((({..||||,.|,...,{.,.{{((({(((,({(((.((((.(({{(((...((((({...(((((((((.((((((((.{.((({..,,,.....|)))|{.({{......)))}},,,,.,.))))...)))).))))}}..{{,....}))...|{{|{,((,(((({{..{{{((({..{{,....}}))))),....)))))).||,{((,((((((....)))))).,,},|||}}})))).})))))....((((((....)))))).,,...,,,.)))))))))).)))))|,{|||{((((.,{(((((...)))))}|..|,|{|....,.},.,}}}},,))}}}..,|||,||}}}|||}}|}}}...,,.((((.....))))((({.(((((((...)))))))}))),,,,....}}}}}))})}}})},}}}}..)})))))..,,.))}}})),})))))}..,}}..,,........,(((((.{{{.....})},)))))...))).}))))),,,)))))...............(((((.......))))).........(((((..............))))).,,.,.,,,}}}}.....,}}}),....)))))))).))).))))))))(((((...(((((((((((.,,,....,,,(((((.(((........)))..))))}..,,...,{{{..,.||,|||||,....,.,{{||||{,{((........}}}..(((((((((..(((...........)))....)))))))))}}}))}))}},......((((((.((...)).)))))).)))))))))})).)))))|,,,,.,{{(((.(({((((((((........)))))))))).})))))|||,||{{,.....,}}}.,,,,(((...)))....))))))))))((((.((((..{{(({{.{{{,,({(({(((.(((((((((((((((((.,,,{({{...,,,}}.,,.((((......))))......)))))))))),.....})))))).)))...})),}}..}}))))}.))))...))))........,....,,,.,,,,..{{(.((((,...})))).))}...)))))).))))))..))))))......((((....((((.............))))..,.)))).....)))},....))))),,)))...(((((.(((..((....))..))).))))).....)))))))))((((((({.,{(((((..((..((((.....})))..))..)))},}}...)))))))).............(((((((((({....}))))))))))..........})))},,.......

Transcripts

ID Sequence Length GC content
AAGCUGCCAGCCAGAGAGGGAGUCAUUUCAUUGGCGUUUGAGUCAGCAA… 2017 nt 0.3867
UUGUUUUUCUCUUUGGCUGUUUUCUCUCACAUUGCCUUCUCUAAAGCUA… 2052 nt 0.3855
Summary

The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is a pleiotropic cytokine involved in various immune responses, inflammatory processes, and hematopoiesis. This cytokine is produced by monocytes and macrophages as a proprotein, which is proteolytically processed and released in response to cell injury, and thus induces apoptosis. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. It has been suggested that the polymorphism of these genes is associated with rheumatoid arthritis and Alzheimer's disease. [provided by RefSeq, Jul 2008]

Forensic Context

A study in porcine skin demonstrated that the IL1A was down-regulated at 1.5, 3, and 6 hours but up-regulated at 24 hours following chlorine vapor exposure, identifying it as a common potential therapeutic target shared among three significantly altered signaling pathways [Price et al. DOI:10.3109/15569527.2012.679374]. In human skin, analysis of thermally injured tissue showed the IL1A was significantly up-regulated in burned tissue across early, middle, and late temporal periods post-injury [Greco et al. DOI:10.1016/j.burns.2009.06.211]. A study in human skin wounds demonstrated that a ratio of IL-1a-positive cells exceeding 30% indicates a wound age ranging from 4 hours to 1 day [Kondo et al. DOI:10.1016/J.Forsciint.2010.07.004]. In a rat model of contusive spinal cord injury, IL-1a gene expression was found to be increased in the injury epicenter at 3 hours post-injury [Aimone et al. DOI:10.1016/j.expneurol.2004.05.042].