Basic Information

Symbol
IL1B
RNA class
mRNA
Alias
Interleukin 1 Beta IL1F2 IL1-BETA Interleukin-1 Beta IL-1 Beta Catabolin IL-1B Pro-Interleukin-1-Beta Preinterleukin 1 Beta Interleukin 1beta IL1beta IL-1
Location (GRCh38)
2:112829751-112836816
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Sudden cardiac death diagnosis Cause of death analysis Mechanical injury analysis
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_000576.3
Sequence length
1507.0 nt
GC content
0.4618

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-428.30 kcal/mol
Thermodynamic ensemble
Free energy: -458.38 kcal/mol
Frequency: 0.0000
Diversity: 454.20
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((.....((((((((.(((((........(((((....(((...)))..))))).((((((((((((((.(((((((...((....)).))))..))).)))))..((((.((.(((((....))))).)).)))))))))))))..))))).))))))))....))).......(((.((((((((((......(((((((.((.(((((((((((((((....)))))......((((....(((((.......(((((((((((.(((..(((((((........)))))))..(((..((.(((((.((...(((((((.(((((......(((((((((((.(((...(.(((...(((((...(((((....)))))))))).(((((((((((......((((((.....((((((((((((...))))).........((((.....((((((..(.(((((((((((......)))..)))).)))).)................(((.((...((((..(.(((((((((((((.((((.....))))))))))))))..))).)..))))..)).)))..............((.((((...)))).))((((..((.........)).))))))))))....)).)))))))))((((((........))))))...)))))).............)))))))))))........((((((((....))))))))............))).)...(((((..(((((((((....)))))).......)))...)))))(((.......))).))).))))))))))).......)))))..(((((((((.((.(........)))..))))))))).....(((((((((.((.......((((((.(((((...(((((.....(((((((((.(((((...((((((((.(((((((........(((....))).))))))).))))).............)))..))))).)))))))))..........(((....))))))))))))))))))).)))))))))))......(((((.........)))))......)))))))..)).))))).)).)))......))).))))))((.((((((((((((.(....)...)))))...........)))))))...))..............((((....))))..........................)))))........)))))......))))..))))))).))).))..))).))))......)))).(((((......))))).(((((((.......((((((((((((((((....(((((....((((((((.(((..((((............)))).))).))))).)))...))))).....)))))..)))))....))))))))))))).......)))))))))............
Thermodynamic Ensemble Prediction
........{(((((((({.{,,(((.({{{{(((((....(((({..,,.{|{{||.((((((((((((((.{(({(({,.,{{,,,,||{|,|},{|}}.}}})),.|||{.{{.{{{{{..,,))})).)).)))))))))))))..,,}}}.},}}}}})}}},|||{{((...{{(.{({{({{{(({{,..||||(((({{({({((({{{{((({(({,{{}}}||||,...|.....,}|.|||,,,....,|||,|||{||}|||,,(((((((........))))))).,|||..||||{((({(({{{((((({{,((({{...,,.({{{{(((({{..,{,|,,,|||,.,|||{({{,((((,,,,,|||||||||..,,,||||||||,.....((((((.....((((({{(((((...}))))..,,....,({{(...,.((((((..{{(((((((((((......)))..)))).}}}}||,.,....,..,,,...|{{,{{,..((((..(.{((((((((((((.((((.....))))))))))))))}.,)}.)..))))..},.,||,..,{.......{{((.((((...)))).)}|||....,..,,..,,},}})))))))))).,..)).))))))))){(((((.{....,.})))))...))))))..........,.,))}))))}})),.....((((((((((....))))))}},}))........}|||}...{((((..(((((((((....)))))).......)))...)))))|{{.......))),})))))))))))))),.,....))}}},||{|{,,,,,.||.|.....,..}},..}}))))))},,,..(((((((((.,,....,..((((((.(((((...(((((.....(((((((((.(((((...((((((((.(((((({........(((....))),})))))).))))).,,,.........)))..))))).)))))))))..........(((....))))))))))))))))))).}))))))))))......|||||}}}}}}}}}))),,..})))).))).,)))))......,..,.,......,,,..,||||{{.((((((({{(({.{........)))))...........)))))))...||{{.,,.....,}..||||....|,||.,{.{{,{{..,{......,|,||||,||||,,,.....|||||,.,,,.,,,.,{||||||||.,,.}|,.|||,,|||,....,}},|{(((((......))))).||,,{{{.......||||||||{|||||||,,}}|,|||....{{{{{{{|.|||},||||.,,,,.,,,,},}})),})).,)))),)))}..,,,,,....,|||||..,,,,,...})))))}}))))}|{{,....,,)))),,)}))}........

Transcripts

ID Sequence Length GC content
NM_000576.3 NCBI
ACCAAACCUCUUCGAGGCACAAGGCACAACAGGCUGCUCUGGGAUUCUC… 1507 nt 0.4618
Summary

The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1 (CASP1/ICE). This cytokine is an important mediator of the inflammatory response, and is involved in a variety of cellular activities, including cell proliferation, differentiation, and apoptosis. The induction of cyclooxygenase-2 (PTGS2/COX2) by this cytokine in the central nervous system (CNS) is found to contribute to inflammatory pain hypersensitivity. Similarly, IL-1B has been implicated in human osteoarthritis pathogenesis. Patients with severe Coronavirus Disease 2019 (COVID-19) present elevated levels of pro-inflammatory cytokines such as IL-1B in bronchial alveolar lavage fluid samples. The lung damage induced by the Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is to a large extent, a result of the inflammatory response promoted by cytokines such as IL-1B. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. [provided by RefSeq, Jul 2020]

Forensic Context

A study in humans analyzing gene expression profiles from atherosclerotic lesions and type 2 diabetes mellitus (T2DM) patients identified the IL1B as a shared hub gene, showing robust predictive performance in artificial neural network models and significant upregulation in an endothelial injury model combining oxLDL and high glucose [Wu et al. DOI:10.3390/ijms27010136]. Another human study on myocardial infarction (MI) identified the IL1B as a hub differentially expressed gene, demonstrating good diagnostic efficiency with validated AUC values across multiple independent cohorts and correlating with specific immune cell populations [Zhang et al. DOI:10.3389/fcvm.2022.939972]. A study in rats demonstrated that the IL1B mRNA expression and lung concentration were significantly increased by either heat exposure or oleic acid injection, and showed a synergistic increase when both insults were combined [Inoue et al. DOI:10.1016/J.Legalmed.2012.06.003]. In human bone marrow, the IL1B gene was upregulated in trauma patients compared to elective hip replacement patients, though it was not significantly different from healthy controls [Kelly et al. DOI:10.1097/SHK.0000000000001826].