Basic Information

Symbol
IL1R2
RNA class
mRNA
Alias
Interleukin 1 Receptor Type 2 CD121b IL1RB CD121 Antigen-Like Family Member B Interleukin-1 Receptor Type II Interleukin-1 Receptor Type 2 Interleukin-1 Receptor Beta IL-1 Type II Receptor IL-1R-Beta IL-1RT-2 CDw121b IL-1R-2 IL-1RT2 Type II Interleukin-1 Receptor, Beta Interleukin 1 Receptor, Type II Antigen CDw121b CD121b Antigen IL1R2c
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Cause of death analysis

MANE select

Transcript ID
NM_004633.4
Sequence length
1462.0 nt
GC content
0.5000

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-467.50 kcal/mol
Thermodynamic ensemble
Free energy: -498.80 kcal/mol
Frequency: 0.0000
Diversity: 394.25
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.((((..(((..(((...(((((.....((((....(.((((((((((((.(((((((.((((.............((((((.(......).))))))..)))).))).)))).)).)))))...))))).)..)))).....))))).)))..)))..)))).)))).......(((((((.((((.(((((((((..(.((((.((((((.....((((.(((((((((........)))))).))))))).)))))))))).)......))))))....))).)))).))))))).............(((((((((.....(((((((((.((((((...((((((((((((...((((((...(.(((......))).))))))).)))))(((((((((....))))...))))).....((((((......(((((((.((.((((.((.((((...)))))).))))...)).)))))))......)))))).)))))))))))))......................((((((..(((...(((((((....)))))))....(((((...(((((..((......))....))))).)))))..)))))))))..(((((((((((...........(((((.......((((((.(.((....)).).)))))))))))....(((((((((((((..((((((((((.(((..((.((((....))))..))...))).))))))))........)).))))).)).........))))))........)))))))))))(((...(((((..(((((((((((..(((((((.....(((((((((((((((.(.((((((......)))..(((((..((((...)))).))))).....(((((((...))))))).))))...)))).)))....)))))).))......(((((((((.((((..(.((((((((.((((((..((((((........((.(((.((((((((((.((((((......((((((.((....)).))))))..)).))))))))).)))))))).)).........)))))).....(((.............))).((((....))))........)))))).)........))))))).)..)))))))))))))))))))))))))))).)))..(((((.....)))))..)))))...)))...))))))..)))....))))))))).(((((.....((((((((((.(((...................))).)))))........(((...((((((((.(......).))))).)))...))))))))..)))))((((..(((((((((..(((......(((...)))(((((.......))))).)))..)))))))))...))))...
Thermodynamic Ensemble Prediction
((((((((((((((,,{{{,,,(((((,,,,{({{{,,{.({(((({(((((((.(((((((.(((({.......,}.,,((((((.(......).)))))).||})),)))|,))).)).)))))...})}}|,|..}}}},}...))))),}))},}}}}}))}||,|||.......{|{|{{|.|{((.((({((({{..{.((((,((({{.....,((((.{{,{{((((,...,,,.}||||},||||}}}.||}|||}}}},).},,..}}}))),,.,))),)))}.))))))),}}..,....,,,(((((((((.....(((((((((.((((((,..(((((((,{.,,.,...((((((((((.((((...(((.((((((((((......))))..)))}))).)))))))..))))))))))..,....,{,,...,}}||{,.{|.|((,...}))))}.||}}((((({...})))))....,,,,.,,)))))))))))))......................((((((..,{{..,(((((((....)))))))}|,,,{{{({,,(((((.,((.,....,,,.}})))),.)))))..)))))))))..(((((((((((,.......,,,,.,{{,..,,}}|..||({({{({,,.||,||}}}.|||{|,|,...||{||||||||{,..,,((((((((.(((..((.((((....))))..))...))).))))))))......,}}).}))})})},{{{{|{...)).))},......}})))))))))(((,{.(((((.{({{{(((((((.{(((((((.....(({((((((((((((.,.,{{||....,,{|,{{{(((((..((((...)))).))))),}},.(((((((...))))))).)))....)))).)))}...})))))},,......(((((((((.((((..{.(((((((.{((({(({.((((((....,.{{((.(((.((((((((((.(((({(......((((((.((....)).))))))..,},)))))))))}}))))))).)),}}......)))))).})).{,,.....,,.,....||,.{(({.,,.}}}}..,.,...,,,)))))}..,).))))))))).}..))))))))))))))))))))))))))}}.}}),.(((((.....)))))..))))).,.)))...)))))}.,)))....)))))))))}}}|},,,,..,|||||||||.{||,...,,.............}}|.|}}}....,}|..(((({.((((((((.(......).)))))},))...))))),,,..}}}|(((((..(((((((((..(({......(((...))}(((((.......))))).}))..)))))))))...)))))}.

Transcripts

ID Sequence Length GC content
GCUGGAGGUGAAAGUCUGGCCUGGCAGCCUUCCCCAGGUGAGCAGCAAC… 1158 nt 0.5086
GCUGGAGGUGAAAGUCUGGCCUGGCAGCCUUCCCCAGGUGAGCAGCAAC… 1462 nt 0.5000
Summary

The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This protein binds interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I(IL1R1/IL1RA), and acts as a decoy receptor that inhibits the activity of its ligands. Interleukin 4 (IL4) is reported to antagonize the activity of interleukin 1 by inducing the expression and release of this cytokine. This gene and three other genes form a cytokine receptor gene cluster on chromosome 2q12. Alternative splicing results in multiple transcript variants and protein isoforms. Alternative splicing produces both membrane-bound and soluble proteins. A soluble protein is also produced by proteolytic cleavage. [provided by RefSeq, May 2012]

Forensic Context

A study in human patients with acute myocardial infarction, myocardial fibrosis, and heart failure identified the IL1R2 as a differentially expressed mRNA, showing downregulation in myocardial fibrosis versus acute myocardial infarction and upregulation in heart failure versus myocardial fibrosis, with involvement in hematopoietic cell lineage and fluid shear stress pathways and demonstrating potential diagnostic value for both acute myocardial infarction and heart failure [Wang et al. DOI:10.3389/fcvm.2021.664044]. A separate study in human sepsis patients found the IL1R2 was upregulated in peripheral blood, adversely associated with 28-day survival, and primarily expressed in monocytes, with its high expression confirmed in lipopolysaccharide-treated THP1 cells [Li et al. DOI:10.1515/biol-2022-0999].