| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUGGAGGUGAAAGUCUGGCCUGGCAGCCUUCCCCAGGUGAGCAGCAAC… | 1158 nt | 0.5086 | |
| GCUGGAGGUGAAAGUCUGGCCUGGCAGCCUUCCCCAGGUGAGCAGCAAC… | 1462 nt | 0.5000 |
The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This protein binds interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I(IL1R1/IL1RA), and acts as a decoy receptor that inhibits the activity of its ligands. Interleukin 4 (IL4) is reported to antagonize the activity of interleukin 1 by inducing the expression and release of this cytokine. This gene and three other genes form a cytokine receptor gene cluster on chromosome 2q12. Alternative splicing results in multiple transcript variants and protein isoforms. Alternative splicing produces both membrane-bound and soluble proteins. A soluble protein is also produced by proteolytic cleavage. [provided by RefSeq, May 2012]
A study in human patients with acute myocardial infarction, myocardial fibrosis, and heart failure identified the IL1R2 as a differentially expressed mRNA, showing downregulation in myocardial fibrosis versus acute myocardial infarction and upregulation in heart failure versus myocardial fibrosis, with involvement in hematopoietic cell lineage and fluid shear stress pathways and demonstrating potential diagnostic value for both acute myocardial infarction and heart failure [Wang et al. DOI:10.3389/fcvm.2021.664044]. A separate study in human sepsis patients found the IL1R2 was upregulated in peripheral blood, adversely associated with 28-day survival, and primarily expressed in monocytes, with its high expression confirmed in lipopolysaccharide-treated THP1 cells [Li et al. DOI:10.1515/biol-2022-0999].