Basic Information

Symbol
IL2
RNA class
mRNA
Alias
Interleukin 2 IL-2 TCGF T Cell Growth Factor Interleukin-2 Aldesleukin Involved In Regulation Of T-Cell Clonal Expansion T-Cell Growth Factor Lymphokine
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_000586.4
Sequence length
1029.0 nt
GC content
0.3333

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-211.00 kcal/mol
Thermodynamic ensemble
Free energy: -234.71 kcal/mol
Frequency: 0.0000
Diversity: 199.68
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((.(((((((((((..............(((((((........(((((((((....(((((((((...........)))))))))((((((......(((((((((..((..((((((((..((((.......))))..))))))))((((...((((...))))....))))..))....))))))))).(((((..((((((((((.((.((..((((...(((((........)))))..........((((...))))................((((((((((((......))))))...))))))....((((..((((((.((.....))))))))...))))....((((....)))).........))))..)).))))))).))))))))))...)))))).)))))))))..............)))))))..............))))))))))).))............((((((((..(((((((((.....)))))).))).................((((((...(((((.....(((.(((...))).))).....))))).....)))))).((((.((((((...((((((((((.(((.((((.((....)).)))).)))...))).)))).)))...))))))))))((((......))))........(((.((((.((....)).)))))))....((((..(((....)))..))))..(((((((.....))))))).........))))))))....................((((((((((((...(((((.((((((.((........))))))))))))).............((((((...(((((......)))))..))))))(((((...)))))...(((((((((.(((........((((..(((....(((((((((........))))))))).....)))..))))..))).))))))))).........))))))))))))
Thermodynamic Ensemble Prediction
.,,.,(,.(((((((((((...{,.........(((((((........(((((((({....((((((((({(((....))}))))))))){(((((......(((((((((..((..((((((((..((((.......))))..))))))))(((({{.((((...)))).}}.))))..}}....))))))))).{{,,...(((((,,,{.|{{.{{..{{{{...(((((........)))))..........,,,,..,||||............,...((((((((((((......))))))...)))))).,,,{(((..((((({,((.....))))))))...)))}..,}{(((....))),....,,{..,,,,,,))})}},))),))})),,,,,.,.)))))).,))))))))..............))))))).........,....))))))))))).||.,||........((((((((..{{{{{((({.....}}|}}},|||,{,.{,.....,,....((((((...(((((.....(((.(((...))).})}..,..))))).....)))))).(((,{((((((.{{((((((((((.(((.,(((.((....)).)))}.)))...))).)))).))},}})))))))))),,,{,,....}))).,....,,|(,{((((.((....)).))))))}....{{{{.,|{{....)))..}|||..(((((((.....))))))).....,,,.))))))))....{,,{{{....,}}}},,{((((((((({,..(((((.((((({{((........))))))))))))).............((((({.,.(((((......)))))..})))))(((((...)))))...(((((((({.{((.,......((((..(((.,,.(((((((((........)))))))))..,}.)))..))))..))).)))))))))........,))))}}}}}}}.

Transcripts

ID Sequence Length GC content
CUAUCACCUAAGUGUGGGCUAAUGUAACAAAGAGGGAUUUCACCUACAU… 1029 nt 0.3333
Summary

This gene is a member of the interleukin 2 (IL2) cytokine subfamily which includes IL4, IL7, IL9, IL15, IL21, erythropoietin, and thrombopoietin. The protein encoded by this gene is a secreted cytokine produced by activated CD4+ and CD8+ T lymphocytes, that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine (IL2R) is a heterotrimeric protein complex whose gamma chain is also shared by IL4 and IL7. The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Sep 2020]

Forensic Context

No relevant information is available at the moment.