| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUAUCACCUAAGUGUGGGCUAAUGUAACAAAGAGGGAUUUCACCUACAU… | 1029 nt | 0.3333 |
This gene is a member of the interleukin 2 (IL2) cytokine subfamily which includes IL4, IL7, IL9, IL15, IL21, erythropoietin, and thrombopoietin. The protein encoded by this gene is a secreted cytokine produced by activated CD4+ and CD8+ T lymphocytes, that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine (IL2R) is a heterotrimeric protein complex whose gamma chain is also shared by IL4 and IL7. The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Sep 2020]
No relevant information is available at the moment.