| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAAGCAGAAUCUUCAGAACAGGUUCUCCUUCCCCAGUCACCAGUUGCU… | 1165 nt | 0.4077 |
This gene is a member of the IL10 family of cytokines that mediate cellular inflammatory responses. The encoded protein functions in antimicrobial defense at mucosal surfaces and in tissue repair. This protein also has pro-inflammatory properties and plays a role in in the pathogenesis of several intestinal diseases. The encoded protein is a crucial cytokine that regulates host immunity in infectious diseases, including COVID-19 (disease caused by SARS-CoV-2). [provided by RefSeq, Dec 2021]
A study in zebrafish demonstrated that the IL22 transcript increased in relative abundance at 24 hours postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267]. A study in mice demonstrated that the IL22 was significantly upregulated at 60 days post-injury in microglia isolated from brains after controlled cortical impact, indicating its role in regulating immune responses during the chronic phase of traumatic brain injury [Izzy et al. DOI:10.3389/fncel.2019.00307].