Basic Information

Symbol
IL22
RNA class
mRNA
Alias
Interleukin 22 IL-TIF ILTIF IL-22 TIFIL-23 Zcyto18 IL-D110 IL-21 TIFa IL-10-Related T-Cell-Derived Inducible Factor Cytokine Zcyto18 Interleukin-22 MGC79382 MGC79384 IL-10-Related T-Cell-Derived-Inducible Factor ZCYTO18
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference Mechanical injury analysis

MANE select

Transcript ID
NM_020525.5
Sequence length
1165.0 nt
GC content
0.4077

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-298.60 kcal/mol
Thermodynamic ensemble
Free energy: -325.17 kcal/mol
Frequency: 0.0000
Diversity: 339.49
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((...........((((((..((....((((((((.....((((((.(((((.((.(((((.((....)).(((.(((((.....((.(((((.(((((....)))))....(((...(((((((.(((((((..((..((....))..)))))))))))))))).)))....))))).))))))))))..))))).)).)))))..))))))....(((((((((............(((((((.....))))))))))).))))).......((((....)))).))))))))))..))))))...((((((((..((((.((((((((((.((....)))))))(((((...(((((....))))).)))))))))).))))..)))))....)))((((((((((.((((((((.((..(((((.((((..((((.(((.....))).))).)..))))....)))))..)).))))((((((((...)).))))))....(((((.(((.(((.(((...((((..(((.((((((((((.....(((((..............)))))((((.((.(((((..(((((....)))))...)))))))))))((((((((((((.........(((((.......((((((..........(((......)))))))))........)))))..((((((.........))))))(((.((((.((.(((.....))))))))))))(((((((((..((((.............(((((((......((((((....))))))....))))))).............)))).)))))))))((((.....))))........)))))))))))).......((((((((.....))))))))..)))))))))))))((((((......))))))...)))))))))).)))....)))))....((((..((.(((((((....((((....))))...)))))))))..))))...((((((.((((......)))).))))))..(((....))).......)))).))))))))))..........(((((((......))))))).........((((((((.(....)))))))))))))..........
Thermodynamic Ensemble Prediction
.{{((..,,.,(({{.((((((.,(({,..,(((((((.....((((((.(((((.((.(((((.((....}}.{{{((((((.....((.(((((.,{(((....)))))....(((...(((((({,(((((({({((..((....))..)))))))))))))))).)))....))))).))))))))))..))))).)).))))}}.))))))....(((((((((............(((((((.....))))))))))).))))).......((((....)))).)))))))))),.))))))...|||{((((..((((.(((({(((((.((....))))))){{(({...(((((....})))).}))))})))).)))}..))))}|||,|||((((((((({.((((((((.({..({{{{.{(((..{(((.(((.....))).))).}..))))...,))))),.}}.)))|((((((((...)),}))))),...(((((.(((.(({,(({...{(({..{((.((((((((((.....((((,.,(({{{...{{.,|,|,|((((,({.(((((.,{((((....))))}...))))))),,})|||,,,||||||}.,.,,.,,..}}}}}.}}}}.,,,............,((......))|{{(((((({,...,,||}}},{{((((.........||||}}.,,.|{||,||.{{{.....}}}}}}}}||||(((((((((.{(({,..,|{|,..,{{,((((({..,||,|||||||}...}))}})},}}}}})},|.,,,,,}......}))).))))))))}((((.....)))),,...,{{||||||||,.,)}}}}}}}||||||||.....))))))))..))))))))))))|((((((......)))))),,.}))))))))).))).,..)))))....,((({.,({(((((((,{{,({({....))))},.)))))}}}},.,))),..,{{|||.||||},}}..}}}},})}))}..||,..|||||||||,,,}}}}.}))))))))}.,|||||,..,{((({,..,,,.,)))})},,},,....(((((((({(....)))))))))}})),....,,...

Transcripts

ID Sequence Length GC content
ACAAGCAGAAUCUUCAGAACAGGUUCUCCUUCCCCAGUCACCAGUUGCU… 1165 nt 0.4077
Summary

This gene is a member of the IL10 family of cytokines that mediate cellular inflammatory responses. The encoded protein functions in antimicrobial defense at mucosal surfaces and in tissue repair. This protein also has pro-inflammatory properties and plays a role in in the pathogenesis of several intestinal diseases. The encoded protein is a crucial cytokine that regulates host immunity in infectious diseases, including COVID-19 (disease caused by SARS-CoV-2). [provided by RefSeq, Dec 2021]

Forensic Context

A study in zebrafish demonstrated that the IL22 transcript increased in relative abundance at 24 hours postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267]. A study in mice demonstrated that the IL22 was significantly upregulated at 60 days post-injury in microglia isolated from brains after controlled cortical impact, indicating its role in regulating immune responses during the chronic phase of traumatic brain injury [Izzy et al. DOI:10.3389/fncel.2019.00307].