| ID | Sequence | Length | GC content |
|---|---|---|---|
| AACAGGAAGCAGCUUACAAACUCGGUGAACAACUGAGGGAACCAAACCA… | 1037 nt | 0.5101 |
This gene encodes a subunit of the heterodimeric cytokine interleukin 23 (IL23). IL23 is composed of this protein and the p40 subunit of interleukin 12 (IL12B). The receptor of IL23 is formed by the beta 1 subunit of IL12 (IL12RB1) and an IL23 specific subunit, IL23R. Both IL23 and IL12 can activate the transcription activator STAT4, and stimulate the production of interferon-gamma (IFNG). In contrast to IL12, which acts mainly on naive CD4(+) T cells, IL23 preferentially acts on memory CD4(+) T cells. [provided by RefSeq, Jul 2008]
A study in humans developed a targeted RNA sequencing protocol to predict the time-of-day of bloodstain deposition using 69 candidate mRNA markers, where the IL23A was excluded from the final analysis panel after initial testing due to a lack of statistically significant expression differences [Gosch et al. DOI:10.1016/J.Fsigen.2025.103287].