Basic Information

Symbol
IL23A
RNA class
mRNA
Alias
Interleukin 23 Subunit Alpha SGRF IL23P19 IL-23A IL-23 P19 Interleukin-Six, G-CSF Related Factor Interleukin 23, Alpha Subunit P19 Interleukin-23 Subunit Alpha Interleukin-23 Subunit P19 IL-23 Subunit Alpha IL-23p19 IL-23-A JKA3 Induced Upon T-Cell Activation Interleukin 23 P19 Subunit
Location (GRCh38)
Forensic tag(s)
Time since deposition estimation

MANE select

Transcript ID
NM_016584.3
Sequence length
1037.0 nt
GC content
0.5101

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-359.90 kcal/mol
Thermodynamic ensemble
Free energy: -376.77 kcal/mol
Frequency: 0.0000
Diversity: 217.10
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..........((((.(((((((((((.....))))))((.......)).((((((((((.........(((((..(((((...(.....)...)))))...)))))(((((....)))))...))))).(((...((((..((((((.....((((......))))....((((((((......))).)))))((((((((((((((((((((......))))))).))..))))))))))).((((((((((((((...(((.((((((....)))))))))((((..(((((((((.((...(((.(....)))).....((((..(((.(.(((((((((((......(((((...(((((.....)))))...)))))..(((((((((((((.((.((.(((((((.((((((......))).))).....(((((..(((..(((.((.....)).)))..)))...)))))(((....)))...(((((((.......)))))))....((((.(((((...((.....))...))))).))))..........))))).)))))).)))))))..((((((......((.........)).....))))))..)))))).....))))))))))).).)))....))))......)))))))))))..))))(((((..(((...((((....)))).))).)))))....))))))))....))))))...))))))..)))).))).(((((((((((((......)))))(((....))).((..(((((((........)))..((((((.......((((((....))))))))))))((((((((....................))))))))((((((((((......))))).)))))........))))..))......))))))))....((((((((.(((....))).))))))))...............(((((((..(......)..)))))))..)))))...))))))))).
Thermodynamic Ensemble Prediction
..........((({,(((({((((((.....))))))({.......}}.((((({{{((,.....,,.(((((..(((((...(.....,...)))))...)))))(((((....)))))...|||}}.,{|}}.((((..((((((.....((((......))))....((((((((......))).))))}((((((((((((((((((((......))))))).))..))))))))))).((((((((((((((.|.(((.((((({....)))))))))|(((..(((((((((.((...(((,....||}}......((({..{((.(.(((((((((((..,.,,(,{{,...,,{||,..{{|||||,..}}))),.||||{{(((((((.{.{((.(((((((.({{{{|,,....}}}.}}}.....(((((..(((..(((.((.....)).)))..))).,.))))){((....,)).,.(((((((.......)))))))|,..((((.(((((...((.....))...))))).)))).,,.......})))).)))))).)))))))..{(((((..,,..({.........)).,.,,))))}|{{|,,,,)}))..))))))))))).}.)))....})))...,..)))))))))))..))))(({{{.,{{{,..((((...,)))).)}).)))))...,))))))))....)))))),..))))))..)))).}}}.((((((({(((((......))))){{{....}}}.((..(((({{{,{,,,,..}}}.,|||||......,{((((((....)))))))))}}}(((((((({..................,))))))))((((((((((......))))).)))))........))))..))......))))))))....((((((((.((,....,)).))))))))........,....,.(((((({..{......}..)))))))..)))))...))))))))).

Transcripts

ID Sequence Length GC content
AACAGGAAGCAGCUUACAAACUCGGUGAACAACUGAGGGAACCAAACCA… 1037 nt 0.5101
Summary

This gene encodes a subunit of the heterodimeric cytokine interleukin 23 (IL23). IL23 is composed of this protein and the p40 subunit of interleukin 12 (IL12B). The receptor of IL23 is formed by the beta 1 subunit of IL12 (IL12RB1) and an IL23 specific subunit, IL23R. Both IL23 and IL12 can activate the transcription activator STAT4, and stimulate the production of interferon-gamma (IFNG). In contrast to IL12, which acts mainly on naive CD4(+) T cells, IL23 preferentially acts on memory CD4(+) T cells. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans developed a targeted RNA sequencing protocol to predict the time-of-day of bloodstain deposition using 69 candidate mRNA markers, where the IL23A was excluded from the final analysis panel after initial testing due to a lack of statistically significant expression differences [Gosch et al. DOI:10.1016/J.Fsigen.2025.103287].