Basic Information

Symbol
IL27RA
RNA class
mRNA
Alias
Interleukin 27 Receptor Subunit Alpha TCCR CRL1 WSX1 Zcytor1 Interleukin-27 Receptor Subunit Alpha T-Cell Cytokine Receptor Type 1 Type I T-Cell Cytokine Receptor Interleukin 27 Receptor, Alpha IL-27 Receptor Subunit Alpha Cytokine Receptor-Like 1 Cytokine Receptor WSX-1 IL-27R Subunit Alpha IL-27R-Alpha IL-27RA IL-27R WSX-1 Class I Cytokine Receptor ZcytoR1 IL27R
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_004843.4
Sequence length
2950.0 nt
GC content
0.5790

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1181.70 kcal/mol
Thermodynamic ensemble
Free energy: -1229.90 kcal/mol
Frequency: 0.0000
Diversity: 632.82
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((((((.((((......))))..(((((((.(((....(((((((((((((((((((((((.((((((...)))))))))..((((((...))))))....((((.(.((((.(((......))))))).)))))))))))))).(((......))))))))).)))))))).)))))))......(((((.((.((((((((((((((.((((((.((....))))).))).))))...))))))).))).))..))))))).)))))))..(((((..(((((((((((((.((.((..((.((((((((((((........(((((......(((((.(((.((((((((((((((((.(((((((((((((((((((((((((((.((....(((((((.(((((.....))))).((..(((.(((((.((((((.....))))))....))))).)))..))................(((....(((....)))..)))...))))))).))))))))))))........(((.((((.(........)))))))).....)))))))))).....)))))))....((.((((((.....(((((..((((((.((((((((((..((....))..)))).)))).........))))))))..)).)))(((((...))))))))))).))..))))))............)))))))))).)(((((..((((((((((..(((((((.......)))))))...)))))............))))).)))))......)).))))).....)))))((.(((((..((((((.(.(..(((..(((...((((....)))).....)))..))).).).))))))..))))).))..)))))))))(((((..((((.(((((.((((((..(((.....)))..((((((.((....((((((..(((((.((((((((.((((((.((.((((....((((((((((((..((((.......((((((((......((((..(((((..((.(((.((((((((((.((((..(((((......)))))..)).))..)))))((((..((((((.......))).)))..)))).(((((.((((((.((.((((((((((...(((((((((..(((....(((....))))))((.(((((...))))))).((((((((((....))))).....)))))..)))))))))..))))...(((((....)))))..(((...))))))))))).)))))).)))))...)))))..)))))..)))))))))((((....))))(((.((((.(((((..(((..((......))...)))....))))).)))))))))))))))....)))).))))))).((((...))))........(((.(((((((.((.(((.((......)).))).)).)))))))..))).))))).....)))).).).))))))))))..(((((((.(((((((..((((...(((((((....)))))))..)))).(((((((.....))).))))..(((((.(((((((((((.(((........))).((((((....))))))((((..(((((....)))))((((((((((((.(((((.(((((((((((((.(((....))).(((((....)))))..((((........))))..((.(((((.((((.....)))).))))).))...)))..)))))))))))))))))).))))))))).(((((((((((((.(((((((.......(((...)))((((((.((...(((.(((...((.((((..(((....))).)))).))...)))..))))))))))).....((((((.(((......))).))))))..))))))).))))))))))..)))))))..(((((((.......)))))))........((((((((((......)))))))))).(((((...(((.((.(((((((.....))).)))).)).))))))))...)))))))))....(((((((((((.....))))))).)))))).)))))..((((((........))))))......)))))))...)).))))))))).)))))..))))))......(((((.((((((..(((..((((.............((...((((((....))))))...))..))))..)))..))((.((((...(((..(((((..(((((((((......((.((((...((((((((....))))))))...)))).))...))))((..((((((...(((((((((((......))......((((((((((.........(((((....((............))....))))).........))))))(((((...))))))))).((.(((((...((((((..(..(((.(.((((...)))).).)))..).))))))...))))).))..))))))))).........(((((.....)))))........))))))..))..................................)))))...)))))..)))..)))).)))))).))))).)).)))))))))))).))))).))))......(((((.(((....)))))))).)))))..))))))).)).))))))))))((((.(((...(((((..(((((((((((.((((.........)))).)))))).....)))))..))))))))..))))..............)))..)))))((((.((........)).)))).))))..(((..(((((((........))))))).)))...
Thermodynamic Ensemble Prediction
((((((((...(((((({.{(((((((.(((....))).))))),,).}}.)))))).)))){,.(((.((((((...)))))))))..|..((((((((({|(({{((((,{({(,((((((((.((((((.......(((({.(((....))),.)))))))))).)))))))).}}))}))))},,,}},(((((.((.((((((((((((((.((({({{((....))))}.))).))))..,))))))).))).))..))))),,,)))))))))(((((..(((((((((((((.((.((..,{.((((((((((((........(((((......(((((.(({.((((((((((.(,(((((((((((((((((((((((((((((((.((....(((((((.(((((.....))))|{(((.(((.(((((.((((((.....))))))....))))).)))..)),},..........,..{((....(((....))),,))).,.))))))).))))))))))))........(((.((((.(........)))))))).....)))))))))).....))))))).))))|,{(({{{{....,,,{(..((((((.((((((((((..((....))..)))).)))).........))))))))..)).}}}|{,{{,,.,.,,))))})){||{.}})))}|{,...,},...)))))))))).}(((((..(((((,((,(,,({(((((,,,,,,.}}})))),,,)))))..}}}}..}}..))))).)))))......)).))))).....)))))({.(((((..((((((.{,.{.(((..(((..{((({....)}}}|}...)))..))).).).))))))..))))).})..)))))))))(((((..((((.(((((.((((((..(((.....))).,((((((.{({,..((((((,.(((((.((((((({,((((((.((.((((....((({({((((((..((((.,..,,.((({{{{,.,,,,.((((..(((((..((.(((,((((((((((.((((..(((((......)))))..)).)}..)))))((((..((((((.......))).)))..)))).{((((.((((((.((.((((((((((...(((((((((,,(({...,(((....))))))||.(((((...)))))}}.((((((((((....))))).....)))))..)))))))))..)))}...,((({....||||,..}||}.,)}))))))))).)))))).))))}...)))))..)))))..))))))))}((((....))))({.,{(((.((({{..,||..|..}}||}.}..})),,,,,)||}}.})))})))))))))).,,.}))).))))))).((((...))))..,,{{{.(((.{{{((((,((.(((.((......}),))).)}.}))))}}..))),))))}.....)))).).).))))))))))..(((((((.(((((((..((((...(((((((....)))))))..)))).(((({(({....)))}})))..(((((.(((((((((((.(((,.......{{{.((((,({...|||||,(((({{(((,,,,,,||||}(((((((((((,{(((((.(((((((((({((,(((,,,.,}}.|||||....)}}}}..|||{,....||{||,...((.(((((.((((.....)))),))))).))...)))}})))))))))))))))))).))))))))).{{.((((((((((.(((((((.......(({...}))((((((.((.,.{({.(((...((.((({..(({....})).)))).))...))),.,}.)))))))).....((((((.(((......))).))))))..))))))).)))))))))),,||||||,,,||||||{,,{{,,,,,})}})..}}....((((((((((......)))))))))).|||||}}}}||},,}||||||,}}}}.))).,,,||,,.,,,))))),).)))))))))....(((((((((((.....))))))).)))))).)))))..((((((,.....,.))))))......)))))))...)).))))))))).))))),.))))))......(((((.((({.{((((...{.......,.......,{(,..((((((....))))))...||{{|||,..,}.},)}}}.,{{{...(((..(((((..(((((((((..{,,,({.((((...((((((((....))))))))...)))).))..,)})),,.,||{(((...(((((((((((......))..,...{{{{{{{{{{.........{{{{{....{,............}},,..}}}}).......,,||||||{(((({..||||||,||{{(,{{({{...{{|||{,.,..|||,|.{|||,..,))),),)))..}.)))))),,.)))}),),..))))))))).........(((((.....)))))........}}}}}}..,...................................)))))...)))))..))),}))})))))))).))))),)).)))))))))))).))))).))))......{{((,{(((....)))))))).)))))..))))))).)).))))))))))((({..((((((((((..{({((((((((.((((.........)))).))))))},.,,}))}}..)}))))))})))))..............)))..)))))((((.((........)).)))).))))..(((.,(((((((......,,)}))))).)))...

Transcripts

ID Sequence Length GC content
GUUCGGCUUCCCGUUGCCGCCUCGGGCGCUGUACCCAGAGCUCGAAGAG… 2950 nt 0.5790
Summary

In mice, CD4+ helper T-cells differentiate into type 1 (Th1) cells, which are critical for cell-mediated immunity, predominantly under the influence of IL12. Also, IL4 influences their differentiation into type 2 (Th2) cells, which are critical for most antibody responses. Mice deficient in these cytokines, their receptors, or associated transcription factors have impaired, but are not absent of, Th1 or Th2 immune responses. This gene encodes a protein which is similar to the mouse T-cell cytokine receptor Tccr at the amino acid level, and is predicted to be a glycosylated transmembrane protein. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the IL27RA was significantly dysregulated in lung tissue 48 hours after 12 Gy thoracic irradiation and was functionally annotated to be involved in Th1 and Th2 cell differentiation and Th17 cell differentiation pathways, indicating its role within a competing endogenous RNA network in the early pathophysiological mechanisms of radiation-induced lung injury [Li et al. DOI:10.1177/1559325819891012].