| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGCUCAGCAGGGCCCUGGAGAGAUGGCCACGGUCCCAGCACCGGGGA… | 4034 nt | 0.5771 | |
| GAUAGUGAGUGAGUUCUCACGAGUUUUGAUGGUUGUAUAAGGGACCCUU… | 4077 nt | 0.5715 | |
| GCACUUCGCUCUCCUGCCAGCAUGUGAAGGUGCCUUGCUUCCCCUUCGC… | 4041 nt | 0.5744 |
The interleukin 2 receptor, which is involved in T cell-mediated immune responses, is present in 3 forms with respect to ability to bind interleukin 2. The low affinity form is a monomer of the alpha subunit and is not involved in signal transduction. The intermediate affinity form consists of an alpha/beta subunit heterodimer, while the high affinity form consists of an alpha/beta/gamma subunit heterotrimer. Both the intermediate and high affinity forms of the receptor are involved in receptor-mediated endocytosis and transduction of mitogenic signals from interleukin 2. The protein encoded by this gene represents the beta subunit and is a type I membrane protein. The use of alternative promoters results in multiple transcript variants encoding the same protein. The protein is primarily expressed in the hematopoietic system. The use by some variants of an alternate promoter in an upstream long terminal repeat (LTR) results in placenta-specific expression. [provided by RefSeq, Sep 2016]
A bioinformatics analysis in humans identified the IL2RB as a core immune-related differentially expressed gene significantly altered in both severe burns and blunt trauma patients, where its downregulation was negatively correlated with upregulated NKT cells [Chen et al. DOI:10.3389/fgene.2022.1038222]. A separate study in humans also identified the IL2RB as a top hub gene with higher expression in healthy controls compared to sepsis patients, classifying it as a potential diagnostic biomarker for the condition [Li et al. DOI:10.3389/fimmu.2024.1445858]. A meta-analysis in humans identified TNFRSF1B as a key hub protein in a neurodegeneration-associated interaction network linked to post-mild traumatic brain injury signaling, where its deficiency leads to poorer TBI outcome [Matyasova et al. DOI:10.4149/gpb_2021038]. A separate single-cell transcriptomic study in a rat model of radiation-induced lung injury identified the orthologous rat gene Tnfrsf1b as associated with inflammatory processes [Shi et al. DOI:10.17305/bb.2024.10357].