Basic Information

Symbol
IL2RB
RNA class
mRNA
Alias
Interleukin 2 Receptor Subunit Beta IL15RB CD122 High Affinity IL-2 Receptor Subunit Beta Interleukin-15 Receptor Subunit Beta Interleukin-2 Receptor Subunit Beta Interleukin 15 Receptor, Beta Interleukin 2 Receptor, Beta IL-2 Receptor Subunit Beta IL-2R Subunit Beta CD122 Antigen P70-75 IL-2RB P75 High Affinity IL-2 Receptor Beta Subunit IMD63
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Cause of death analysis

MANE select

Transcript ID
NM_000878.5
Sequence length
4034.0 nt
GC content
0.5771

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1586.60 kcal/mol
Thermodynamic ensemble
Free energy: -1654.18 kcal/mol
Frequency: 0.0000
Diversity: 731.32
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((((((((((.((((.(.((((((.((.....(((..((((((((..((((((((.(.(((((((..((.((((.....((((((((......)))).)))).......))))..))..))))))).).)))))).....(((....)))...))...)))))))).))))).))))))))))).)))).)))))((((((((((((......))).))))).))))..........((((.......)))).(((((((((.((((.(...(((((..((((((....))))))..)))))...).)))).........((((((((((((...((((((((((((((...((.((((((((((.((((((((.((....((((((.(.((((((((((((((((.(((((....)))))(((...)))...))))))))(((((((...(((((((((.(((((((((.((((((((((.(((..(((((.....)))))........))))))))))...))).))))))).(((((....((((....))))....)))))......(((((....))))).(((((..(((.((.............)))))..)))))..(((((.....((((((.....)))))).(((((.....(((((........)))))..((((((..((((.((.((((.(........))))).))...(((.(((((((((((((((((((..((((.....))))..((((........))))...(((((((((((((.(((((.(((((....(((.(.((((..(((((.((...)).))))).))))))))....)))).).))))).....)))))...))))))))........((((.(((((.........))))).))))...((((.((((((((..((((.((..(((...)))..))))))((((.(.(((((.(((......)))...))))).).)))).((((....((((.(((.......))))))).......)))))))))))).))))))))).)))))))))).))))..)))...((((((((.(((((((..(((((.(((((((.(((((...))))).(((((((........))).))))...((((........))))..))))))).)))))..(((((((..........(((.......))).))))))).(((((((((.(((.(((.((................((....)).(((((((((((....((((((.......)))))).))))))))))).....)).))))))))))))))).((((((((.((.((.....(((.(.((((.....)))).)...))).))))))))))))..))).))))((.(((....))))))).))))))....(((((((((((((((((((.((((.(((((.((....(((((...)))))(((((((((((.(.(((((((........(((((((.......))))))).))))))).))))).))))))).((((.(...((((..(((((((((.((.(((((((((((((((((.((((.((((......(((((((((((((.((((((.(((((((...))))))).))))))((((((((........((......)))))))))))))))).........))))))).......)))).)))))))))......((((((.((((.(((.(((...(((((((((((((....))))))((((......))))......((((((((....)))))))).((((((((((...((((((...))))))....)))).))))))..)))))))((((((.....(((.(((.......))).)))))))))............))))))))))..))))))..((((..(.(((((.(((.(((((..((.((.((((((...............)))))))).))..)))))..)))..........))))).).))))....))))))))))))))))))).....))))...)))).....).))))...((((((.....))))))...........((((.....))))..)).)))))))))))....((.(((.......))).))...(((((((((.................)).)))))))......((((...)))).......)))))))))))))))))((((((......(((.((((....))))...))).....))))))..))))..))))))...)))))....)))))..(((((...))))).......)).)))))))))....))))).))......)))))))).)(((.((((............)))))))....((((((((.(((((((.(..(((..((((((((.....))))))))..)))..)))).............((((((((......))))))))..))))..))))))))..((((((..((......))..)))))).............))))))..))))))).))).)))))))))))).............((((((((..(((....((.(((.((((.((((...))))......((((((.(((((((((((..(((.............)))..)))).)))))))........(((((((.(((((..(((((((..((((((....))))))......))))))).))))).))).))))......(((((((...))))))).......))))))...)))))))))..))))))).))))..)))))))).))))))....))..........)))))))))))))))))))(((((..........((((.............))))...........))))).........)))))))..(((((((.(....((((((((((((..(((((((.((.......(((((((..(((........)))(((((......))))).....((((...(.((((((((.((...)).)))).)))).)....)).))....(((((((.(((((((((((.((..(((((.((.(.((((...(((.((...(((((.((.(((((((((((.((((..((((((.(((..(.(((((((((((.((..(((.((.((((((.(((((((....)).))))).)).)))))).))).....))...))))))))))).).((((((.......))))))...((((.....)))).((((((........))))))))).))))))..)))).))))))))))).)).((((((((.((....)).)))))))).((((((((.((.(.(((.((((.((.((((((((...((((....))))..........))).))))).))..)))).((((((....))))))))).).))))))))))..............)))))...))..)))...).))).).)).)))))..)))))........))))......(((.(((.........))))))..))))...)))))))))))))).)).)))))))....))))).)))))))...).)))).......((((((((((...((((.((...(((......((((((((((.(..((....))..).)))).)))))))))..)).))))...))))))))))......(((((...(((((((..((((((((((.(((.....................))).)))))))..)))....)))))))....)))))...(((((((((((((.(((..(((((....)))))..))).))))))))))))).....((((((.((((..((((((......)))))).)))).......))))))(((((.......)))))..))).
Thermodynamic Ensemble Prediction
.((((((((((((((((.,(((,(.((((((.((...,,({{..((((((((..((((((((.(.(((((((..((.((({{....((((((({......}))).))))..,...,))))..))..))))))).}.)))))}.....(((....)))...}}...)))))))),))})).)))))),)))),)))).}))))((((((((((((......))}.))))).))))..........((((.......)))),(((((((((.((,{.((({((((({{((((((....))))}}..,}|||...|,},||{{......)|||||||||,{,...((((((((((((((...(,.((((((((((.((((((((.((....((((((.((((((((((((((((((.{((((....))))}(((...)))|..)))))))}(((((((...(((((((((.(((((((((.((((((((({,(((.,(((((,...,))))).......,)))))))))}..,))).))))))).(((((....((((....))))....)))))....(((((((....))))},)).............,...((((((.((((,.((((..((((..((((..{(((((.....)))))|{((((({....(((((........))))).,((((,,..((.{{{,{(((({(.{.{{{...((((.({{,.(((.(((((((((((((((((((..((((.....)))){.((((.,,...,||}}},|,(((((((((((((,(((({.{((((....(((.(.((((..(((((.((...)).))))).)))),)))....)))).).)))))...,.)))))}..,)))))))....,,..((((.(((((.........))))).)))).,,((((.((((((((..((({,((..(((...)))..))))))((((.(.(((((.(((......}})...))))).).)))).((((....((((.(((.......))))))).......)))))))))))).))))))))),}))))))))).))))..))).}..))})))).|||{|,,..(((((.(((((((.(((((...))))).(((((((........))).))))...((((........))))..))))))).)))))..(((((((..........,{{.......))).))))))).(((((((({,(({,(((.((,.......,,,,...........|.(((((((((((....((((((.......)))))).))))))))))).....,,.))))))))))))))).(((((((,.(,.({.....||,,|}||||}},}}))}).),}}}})})))}}}}}}},,..)))}))))((.(((....)))})},..|},,}|...(((((((((((((((((((.((((.(((((.((....{((({...})))){((((((((((.(.(((((((........(((((((.......))))))).))))))).))))).))))))}.((((.(...((((..(((((((((.((.((((((((((((((({{(((((.((((...,..((((((((((((({((((((.(((((((...)))))))}))))))((((((((........((......)))))))))))))))).........)))))))..,....)))).))))))))}......{(((((.((((.(((.(((...((((((((((((({{..|,))))||{(,{.|,.,,))..},|,((((((((....)))))))),((((((((((...((((((...))))))....)))).)))))).,,))))))((((((.....({{.(((.......))).))}))))))............))))))))))..))))))..((((..,.(((((.(((.(((((..{(.((.(((((({..,......,,,..}}))))}).}}..)))))..)))..........))))).}.))))...}))))))))))))))))))).....))))...)))).....).))))...((((((.....))))))..........{((({.....}}))}})).)))))))))))....{{.(({.......))).}}...((((((({{.................)).)))))))......((({...}))).......)))))))))))))))))...|,.....))))))))..)))).),)))))))))),.({(((({......,....}......)))))))}|..{{.{((((...)))))))..}..)).)))))))))....))))).))......)))))))}{{.,.|||||,,,,,|,....,||||}}.....((((((((.({{(.,,.,..{{{..{((((((({..,,||||}||}..))}}}}}},...,,...}},..((((((((,....,))))))))}})))),.))))))))..((((((..((......))..))))))........}}...))))))..))))))).))).)))))))))),}.,...........((((((((..{((..,.((.(((.((((.((((...))))......((((((.((((((((({(,,((({............}}),,)))).)))))))........(((((((.(((((..((((((({,((((((....)))))),.....))))))).))))).)))},)))....,.(((((((...))))))).......))))))...))))))))).,))))))).))))..))))))))}}))))),}})))}}}}}},...,,,,,,})),)))))))))|((((..........((((.,........}}.))))...........))))}......,.,)))))))..(((((((.{....((((((((((((..(((((((.((.......(((((((,,,((,,.....,}},{((((,.....}}}}}.....{{,{,....((((((((.{(...}}.)))).)))},|....}).}}....{((((((.((((,{((((({{{..(((((.((.(.(((,{{{(((.{{...(((((.((.(((((((((((.((((..((((((.(((..{.(((((((((((.(((.(((.((.((((((.(((((((....)).))))).)).)))))).)))...,.})...))))))))))).}.((((((.......))))))...((((.....)))).((((((........))))))))).))))))..)))).))))))))))).)).((((((((.((....)).)))))))).{((((({{,({.{.||,.{|((.{{.((((((((...{({{,,..,,,,..,.......))).))))).}}.,)))).((((((....)))))),},.},)})))))))}..............)))))...}}..)))}}}}.))).).}}.)))))..))}}}........)))}......|||.|||.......,,))))},..))))...))))))),)))))).}}.)))))))....))))).)))))))...}.)))).......((((((((((...((((.((...{{,....,.((((((((((.,..((....))..,.)))).))))))}))..}).))))...))))))))))......(((((...(((((((..((((((((((.(((.,,,,....,,,,........))).)))))))..))}....)))))))....)))))...{((((((((((((.(((..({(((....))))}..))).))))))))))))}...,,((({{,.{{{{,,(({{{,....,,)))})}...,..,,,..})))}}}(((((.......)))))..))).

Transcripts

ID Sequence Length GC content
AGAGCUCAGCAGGGCCCUGGAGAGAUGGCCACGGUCCCAGCACCGGGGA… 4034 nt 0.5771
GAUAGUGAGUGAGUUCUCACGAGUUUUGAUGGUUGUAUAAGGGACCCUU… 4077 nt 0.5715
GCACUUCGCUCUCCUGCCAGCAUGUGAAGGUGCCUUGCUUCCCCUUCGC… 4041 nt 0.5744
Summary

The interleukin 2 receptor, which is involved in T cell-mediated immune responses, is present in 3 forms with respect to ability to bind interleukin 2. The low affinity form is a monomer of the alpha subunit and is not involved in signal transduction. The intermediate affinity form consists of an alpha/beta subunit heterodimer, while the high affinity form consists of an alpha/beta/gamma subunit heterotrimer. Both the intermediate and high affinity forms of the receptor are involved in receptor-mediated endocytosis and transduction of mitogenic signals from interleukin 2. The protein encoded by this gene represents the beta subunit and is a type I membrane protein. The use of alternative promoters results in multiple transcript variants encoding the same protein. The protein is primarily expressed in the hematopoietic system. The use by some variants of an alternate promoter in an upstream long terminal repeat (LTR) results in placenta-specific expression. [provided by RefSeq, Sep 2016]

Forensic Context

A bioinformatics analysis in humans identified the IL2RB as a core immune-related differentially expressed gene significantly altered in both severe burns and blunt trauma patients, where its downregulation was negatively correlated with upregulated NKT cells [Chen et al. DOI:10.3389/fgene.2022.1038222]. A separate study in humans also identified the IL2RB as a top hub gene with higher expression in healthy controls compared to sepsis patients, classifying it as a potential diagnostic biomarker for the condition [Li et al. DOI:10.3389/fimmu.2024.1445858]. A meta-analysis in humans identified TNFRSF1B as a key hub protein in a neurodegeneration-associated interaction network linked to post-mild traumatic brain injury signaling, where its deficiency leads to poorer TBI outcome [Matyasova et al. DOI:10.4149/gpb_2021038]. A separate single-cell transcriptomic study in a rat model of radiation-induced lung injury identified the orthologous rat gene Tnfrsf1b as associated with inflammatory processes [Shi et al. DOI:10.17305/bb.2024.10357].