| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGACAGACUACACCCAGGGAAUGAAGAGCAAGCGCCAUGUUGAAGCC… | 1480 nt | 0.5047 |
The protein encoded by this gene is an important signaling component of many interleukin receptors, including those of interleukin -2, -4, -7 and -21, and is thus referred to as the common gamma chain. Mutations in this gene cause X-linked severe combined immunodeficiency (XSCID), as well as X-linked combined immunodeficiency (XCID), a less severe immunodeficiency disorder. [provided by RefSeq, Mar 2010]
A study in porcine skin demonstrated that cutaneous bromine vapor exposure significantly increased the IL2RG transcript by 3.91-fold after 10 minutes and 2.73-fold after 20 minutes, identifying it as a common potential therapeutic target for bromine-induced skin injury [Rogers et al. DOI:10.1002/jbt.20383]. In human research, analysis of salivary extracellular vesicles revealed the IL2RG mRNA was significantly upregulated in emergency department patients with acute traumatic brain injury compared to healthy controls, supporting its role as an inflammation biomarker for diagnosis and evaluation of injury severity [Cheng et al. DOI:10.4103/1673-5374.266924].