Basic Information

Symbol
IL2RG
RNA class
mRNA
Alias
Interleukin 2 Receptor Subunit Gamma CD132 Cytokine Receptor Common Subunit Gamma Interleukin 2 Receptor, Gamma IL-2 Receptor Subunit Gamma IL-2R Subunit Gamma CD132 Antigen IL-2RG SCIDX1 GammaC CIDX IMD4 P64 Nonfunctional Common Cytokine Receptor Gamma Chain Common Cytokine Receptor Gamma Chain Interleukin-2 Receptor Subunit Gamma Combined Immunodeficiency, X-Linked Severe Combined Immunodeficiency SCIDX
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Sudden death from CNS diseases

MANE select

Transcript ID
NM_000206.3
Sequence length
1480.0 nt
GC content
0.5047

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-425.30 kcal/mol
Thermodynamic ensemble
Free energy: -454.66 kcal/mol
Frequency: 0.0000
Diversity: 327.66
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((......((((((((((((.(.((.(((.....)))...))).))))).((((((((.(((.((((((((((((((......)))).)))))))))).(((((((((.(((.((((.(((...(((((..(((((...((....))...)))))..............((((((.....))))))...............)))))..))))))).))))))))))))...((((((.((.....)).))))))...(((.(((((((((....((((((((....((((..((((((((.(..........).))))))(((..((.(((((((((......((.((........))))....))))))))))))))...........(((((((......((((.....((((.(((((((((.(((((........(((.((((((.((.....(((.(((((((.......)))...))))))).)).)))))).)))..............(((((.......)))))((((((.(((..(.(.((((.(.(((..(.((((.((((....)))))))))..))).).)))).).)..))).))))))......)))))))))))))).)))).....)))).......)))))))))..))))))).))))).((((((.....))))))..))))))))).))).....((((...)))).(((((...))))))))))))))))...........)).)))))((((.....)))).((((......)))).)))))))(..((((.((((.((......))..))))))))..)(((.((((((((((.(((((((.(.((.((((.((..(((((((........)))..))))..))..)))).))))))))))((........))......(((((((...((((...(((((((...(...(((((((((((((........)))))))....((.(((.(((.......)))))).))(((.(((..((((((((((((((.((((((.((((((((((((......((((.....)))).)))))....)))))))..((.(((.((..........)).))).))..))))))....((((.(((((((....(((((......)))))....(((((.((..((((.....(((..((((............................)))).)))...))))..)))))))..(((((..(((....((((..(((......)))..))))...........))).....)))))...)))))))...))))...))))))))))))).)..))).)))...................))))))...)...))).)).))..))))..)))))))........((((((...))))))))))))))))))).....
Thermodynamic Ensemble Prediction
.(((((((......((((((((,(({.(.((.{{,{,.,,|}|,..}}}.})}}..((((((((.(((.{(((((((((((((......)))).)))))))))}.(((((((((.(((.((((,((,...(((,,{.(((((.,.({....})...))))).}..}}}....},.((((((.....))))))......{{{{{....,,,))}}))})))).)))))))))))},,,(,((((,({.....}},}}}}}|...(((.(((((((((....((((((((....((((..((((((((,(,.........}.)))))|{{{..{(.(((((((((.,....{{.((........))))...,))))))))))))}),..........(((((((.,....((((..,..((((.(((((((((.(((((........(((.((((((.{,..,{.(((.(((((((.......)))..,))))))).}),)))))).))).,.........,,,{({{,.....}}))),.((((((.(((..(.(.((((.,.{{{,,|.{{{,.{{((....)))})))}}..))),}.)))).}.)..))).))))))......)))))))))))))).))))..,..)))).....,.)))))))))..))))})).))))).((((((.....))))))}.))))))))).))).....((((...)))).|||||,,.))))}))))))))))).,.....}}.})).)))))((((.....))))...,({{,...}})),)))))))(,.{(({{((((.((......))..)))))))),}}((,{((((((((((.(((((((.(.((.((((.((.,(((((((........)))..}))),,,)}.)))).))}))))))),,..,.....,,......(((((((...((((...(((((((.,.{...(((((((((((((,,...,,.))))))).,,.((.((,,(((.......)))))).)){({.(((..{(((((((((((((.{{((((.((((((((((((.,....((((.....)))),)))))....)))))))..|{.(({.{{..,....}..}).}}}.}}..}}})}}....(({{.(((((({....(((((......)))))..{.(((((.,{..((((.....(((..((((..{.{...................},..)))).)))...))))..,,)))))..{((({,,{,,....|{({..(((......)))..))}|,,.......,,||,...,,)}}})...)))))))...))))...))))))))))))).}..))}.}}},.,,...............))))))...,...))),)}.}}..))))..)))))))........((((({...))))))))))))))))))).....

Transcripts

ID Sequence Length GC content
ACAGACAGACUACACCCAGGGAAUGAAGAGCAAGCGCCAUGUUGAAGCC… 1480 nt 0.5047
Summary

The protein encoded by this gene is an important signaling component of many interleukin receptors, including those of interleukin -2, -4, -7 and -21, and is thus referred to as the common gamma chain. Mutations in this gene cause X-linked severe combined immunodeficiency (XSCID), as well as X-linked combined immunodeficiency (XCID), a less severe immunodeficiency disorder. [provided by RefSeq, Mar 2010]

Forensic Context

A study in porcine skin demonstrated that cutaneous bromine vapor exposure significantly increased the IL2RG transcript by 3.91-fold after 10 minutes and 2.73-fold after 20 minutes, identifying it as a common potential therapeutic target for bromine-induced skin injury [Rogers et al. DOI:10.1002/jbt.20383]. In human research, analysis of salivary extracellular vesicles revealed the IL2RG mRNA was significantly upregulated in emergency department patients with acute traumatic brain injury compared to healthy controls, supporting its role as an inflammation biomarker for diagnosis and evaluation of injury severity [Cheng et al. DOI:10.4103/1673-5374.266924].