| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGCCCCACGAAGGACCAGAACAAGACAGAGUGCCUCCUGCCGAUCCA… | 924 nt | 0.4762 |
The protein encoded by this gene is a potent growth promoting cytokine. This cytokine is capable of supporting the proliferation of a broad range of hematopoietic cell types. It is involved in a variety of cell activities such as cell growth, differentiation and apoptosis. This cytokine has been shown to also possess neurotrophic activity, and it may be associated with neurologic disorders. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the IL3 was one of the most induced genes in microglia at 60 days post-controlled cortical impact, indicating its role in the chronic phase of the neuroinflammatory response following traumatic brain injury [Izzy et al. DOI:10.3389/fncel.2019.00307].