| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCGUUAGCUUCUCCUGAUAAACUAAUUGCCUCACAUUGUCACUGCAAA… | 615 nt | 0.4520 | |
| AUCGUUAGCUUCUCCUGAUAAACUAAUUGCCUCACAUUGUCACUGCAAA… | 716 nt | 0.4777 | |
| AUCGUUAGCUUCUCCUGAUAAACUAAUUGCCUCACAUUGUCACUGCAAA… | 567 nt | 0.4462 |
The protein encoded by this gene is a pleiotropic cytokine produced by activated T cells. This cytokine is a ligand for interleukin 4 receptor. The interleukin 4 receptor also binds to IL13, which may contribute to many overlapping functions of this cytokine and IL13. STAT6, a signal transducer and activator of transcription, has been shown to play a central role in mediating the immune regulatory signal of this cytokine. This gene, IL3, IL5, IL13, and CSF2 form a cytokine gene cluster on chromosome 5q, with this gene particularly close to IL13. This gene, IL13 and IL5 are found to be regulated coordinately by several long-range regulatory elements in an over 120 kilobase range on the chromosome. IL4 is considered an important cytokine for tissue repair, counterbalancing the effects of proinflammatory type 1 cytokines, however, it also promotes allergic airway inflammation. Moreover, IL-4, a type 2 cytokine, mediates and regulates a variety of human host responses such as allergic, anti-parasitic, wound healing, and acute inflammation. This cytokine has been reported to promote resolution of neutrophil-mediated acute lung injury. In an allergic response, IL-4 has an essential role in the production of allergen-specific immunoglobin (Ig) E. This pro-inflammatory cytokine has been observed to be increased in COVID-19 (Coronavirus disease 2019) patients, but is not necessarily associated with severe COVID-19 pathology. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Aug 2020]
A systematic review of human skin wounds from forensic autopsies found that the proteomic marker IL-4, which is believed to proliferate fibroblasts, demonstrates higher expression levels in vital wounds compared to post-mortem wounds, indicating its utility for vitality differentiation [Ros et al. DOI:10.3389/fmed.2021.786798].