Basic Information

Symbol
IL4
RNA class
mRNA
Alias
Interleukin 4 IL-4 Lymphocyte Stimulatory Factor 1 BCGF-1 BCGF1 BSF1 B_cell Stimulatory Factor 1 B Cell Growth Factor 1 Interleukin-4 Binetrakin Pitrakinra MGC79402 BSF-1 B-Cell Stimulatory Factor 1
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_000589.4
Sequence length
615.0 nt
GC content
0.4520

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-170.40 kcal/mol
Thermodynamic ensemble
Free energy: -181.42 kcal/mol
Frequency: 0.0000
Diversity: 145.16
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((((.(((((((((...............)))))).........((.(((((....))))).)).....(((((((((..((((.((((((....((((.((....)).))))((((((((....)))).))))..((((((.(((...))).))).)))........))))))...((((((((....).)))))))..((..(((((((((..(((..(((((.(((((..............(((((((((...)))))).)))(((((.((((((......))))))...))))).....(((.......)))..((((((((...((((((...)))))))).))))))...))))).))...)))..)))..)))).))))).)).......)))).((((..(((((...((((......).)))..)))))..)))))))).)))))..........))).)))))...)))))(((((((...((((((((((..((......))))))))))))..)))))))(((((..(((((((((((((........(((((....)))))........)))))))))).)))..)))))....
Thermodynamic Ensemble Prediction
.((((((((((.(((,({,,.......,,,......,|||,...,},,...((,{(({,....})))).}}.....(((((((((..({{{.,{(((((({{((,,{({.,{{|,.||||{(((((((....)))).}}))}}|,,,{|,{||..})))}}}}.}||,,....,})).,,|...((((((({....}.)))))))...,..({{{{((((..(((..(((,,,(((((......,.......(((((((((...)))))).)))(((((.((((((......))))))...))))).....{{{..,,...}}}|.((((((((...((((((...)))))))).))))))...))))).}}...)))..)))..)))).)))}}{||}}|....)))},(({{..(({{|...|||||.|,..,.}}))))))))..)))))))).)))))......,,..))).)))))}..}))))|((((((,..((((((((({.,((......))))))))))))..))))))}({(((..(((((((((((((........(((((....)))))........)))))))))).)))..))))}....

Transcripts

ID Sequence Length GC content
AUCGUUAGCUUCUCCUGAUAAACUAAUUGCCUCACAUUGUCACUGCAAA… 615 nt 0.4520
AUCGUUAGCUUCUCCUGAUAAACUAAUUGCCUCACAUUGUCACUGCAAA… 716 nt 0.4777
AUCGUUAGCUUCUCCUGAUAAACUAAUUGCCUCACAUUGUCACUGCAAA… 567 nt 0.4462
Summary

The protein encoded by this gene is a pleiotropic cytokine produced by activated T cells. This cytokine is a ligand for interleukin 4 receptor. The interleukin 4 receptor also binds to IL13, which may contribute to many overlapping functions of this cytokine and IL13. STAT6, a signal transducer and activator of transcription, has been shown to play a central role in mediating the immune regulatory signal of this cytokine. This gene, IL3, IL5, IL13, and CSF2 form a cytokine gene cluster on chromosome 5q, with this gene particularly close to IL13. This gene, IL13 and IL5 are found to be regulated coordinately by several long-range regulatory elements in an over 120 kilobase range on the chromosome. IL4 is considered an important cytokine for tissue repair, counterbalancing the effects of proinflammatory type 1 cytokines, however, it also promotes allergic airway inflammation. Moreover, IL-4, a type 2 cytokine, mediates and regulates a variety of human host responses such as allergic, anti-parasitic, wound healing, and acute inflammation. This cytokine has been reported to promote resolution of neutrophil-mediated acute lung injury. In an allergic response, IL-4 has an essential role in the production of allergen-specific immunoglobin (Ig) E. This pro-inflammatory cytokine has been observed to be increased in COVID-19 (Coronavirus disease 2019) patients, but is not necessarily associated with severe COVID-19 pathology. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Aug 2020]

Forensic Context

A systematic review of human skin wounds from forensic autopsies found that the proteomic marker IL-4, which is believed to proliferate fibroblasts, demonstrates higher expression levels in vital wounds compared to post-mortem wounds, indicating its utility for vitality differentiation [Ros et al. DOI:10.3389/fmed.2021.786798].