Basic Information

Symbol
IL5
RNA class
mRNA
Alias
Interleukin 5 IL-5 TRF Eosinophil Differentiation Factor T-Cell Replacing Factor Interleukin-5 EDF Colony-Stimulating Factor, Eosinophil B-Cell Differentiation Factor I Interleukin 5 (Colony-Stimulating Factor, Eosinophil) B Cell Differentiation Factor I
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Other applications

MANE select

Transcript ID
NM_000879.3
Sequence length
815.0 nt
GC content
0.3693

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-191.70 kcal/mol
Thermodynamic ensemble
Free energy: -207.73 kcal/mol
Frequency: 0.0000
Diversity: 181.42
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..........((((((...((((((((((((((((((((......))).)))).))))))......)))))))((((((((.((..(((...((((((.......((((((..((((((...(((((...(((.......)))...)))))...........((((........)))).((((.(..((((((.((..(.((((((((((((((..............))))))((((((.....)))))))))))))).)..))..))))))..).)).))..)))))).))))))...(((.............)))(((....)))..))))))....)))..........(((.(((.(((.....((.....)).......)))))).)))..)).)))))))).((((((((.....))))))))(((.(((((((.((((.......))))..)))))))...))).......(((((((((((((.((((((.((((.(((((((.((((((............)))))).))))))).)...(((((..(((.....)))..))))).((((.((((...........)))).))))))))))))))))).....(((((((((((......)))..)))))))))))))))))))))))((((((.((((...((((((..........((((.((((((.((.((((((...)))))))))))))).))))..))))))...)))).)))))).(((((((..((((.(((((.....))))).)))).)))))))........
Thermodynamic Ensemble Prediction
....,,....((((((({,((((((((((((((((((((......)))}}))).))))))......))))))){(((({{{,||,,(((..,((((((..,....((((((..((((((...(((((...(((.......)))...))))){,..{{.....,.,|......,.,)}.,||{{.,..((((((.((..,.((((((((((((((..............))))))((((((.....)))))))))))))).,..))..))))))..,.)).)}..)))))).))))))...(((.............))),{{.....,}..)))))},,..)))..........{((.{{(.(((,....{{,,...}}.......))))}}.}}}..}}.}}}))))}.((((((((.....)))))))){{|,{{{{{{{,{(({.,,....,,,||||}},}},.,}))}.....,{(((((((((((((.((((((.((((.(((((((.((((((..,,.....,,.)))))).))))))).)...{{((,.{(({.....}}}}})}}}}.{(((.((((...........)))).)))}))))))))))))).....(((((((((((......)))..))))))))))))))))))},...,,,|...,|}}}}}}||}},,,,..(({{{({((,,(({(({((.((((((...)))))))))))))}.)})}})))))..,})))))}}.{|||.{((((((..((((.(((((.....})))).)))).)))))))..}}}}..

Transcripts

ID Sequence Length GC content
AUGCACUUUCUUUGCCAAAGGCAAACGCAGAACGUUUCAGAGCCAUGAG… 815 nt 0.3693
Summary

This gene encodes a cytokine that acts as a growth and differentiation factor for both B cells and eosinophils. The encoded cytokine plays a major role in the regulation of eosinophil formation, maturation, recruitment and survival. The increased production of this cytokine may be related to pathogenesis of eosinophil-dependent inflammatory diseases. This cytokine functions by binding to its receptor, which is a heterodimer, whose beta subunit is shared with the receptors for interleukine 3 (IL3) and colony stimulating factor 2 (CSF2/GM-CSF). This gene is located on chromosome 5 within a cytokine gene cluster which includes interleukin 4 (IL4), interleukin 13 (IL13), and CSF2 . This gene, IL4, and IL13 may be regulated coordinately by long-range regulatory elements spread over 120 kilobases on chromosome 5q31. [provided by RefSeq, Jul 2013]

Forensic Context

A review of single-cell transcriptome studies in forensic medicine notes that the transferrin-encoding gene (Trf) is a potential indicator or prognostic marker for mild traumatic brain injury (mTBI)-induced cognitive impairments, as it was found to be upregulated in oligodendrocytes after mTBI in mice [Yang et al. DOI:10.1007/s00414-022-02889-9]. A study in mice demonstrated that UVB irradiation induced significant differential expression of specific tRNA-derived fragments and stress-induced RNAs in skin tissue, with tRF-Val-AAC-012 and tRF-Val-CAC-018 being significantly up-regulated and tRF-Gly-CCC-019 and tRF-Trp-TCA-001 being significantly down-regulated [Fang et al. DOI:10.3389/fcell.2021.707572].