| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUGCACUUUCUUUGCCAAAGGCAAACGCAGAACGUUUCAGAGCCAUGAG… | 815 nt | 0.3693 |
This gene encodes a cytokine that acts as a growth and differentiation factor for both B cells and eosinophils. The encoded cytokine plays a major role in the regulation of eosinophil formation, maturation, recruitment and survival. The increased production of this cytokine may be related to pathogenesis of eosinophil-dependent inflammatory diseases. This cytokine functions by binding to its receptor, which is a heterodimer, whose beta subunit is shared with the receptors for interleukine 3 (IL3) and colony stimulating factor 2 (CSF2/GM-CSF). This gene is located on chromosome 5 within a cytokine gene cluster which includes interleukin 4 (IL4), interleukin 13 (IL13), and CSF2 . This gene, IL4, and IL13 may be regulated coordinately by long-range regulatory elements spread over 120 kilobases on chromosome 5q31. [provided by RefSeq, Jul 2013]
A review of single-cell transcriptome studies in forensic medicine notes that the transferrin-encoding gene (Trf) is a potential indicator or prognostic marker for mild traumatic brain injury (mTBI)-induced cognitive impairments, as it was found to be upregulated in oligodendrocytes after mTBI in mice [Yang et al. DOI:10.1007/s00414-022-02889-9]. A study in mice demonstrated that UVB irradiation induced significant differential expression of specific tRNA-derived fragments and stress-induced RNAs in skin tissue, with tRF-Val-AAC-012 and tRF-Val-CAC-018 being significantly up-regulated and tRF-Gly-CCC-019 and tRF-Trp-TCA-001 being significantly down-regulated [Fang et al. DOI:10.3389/fcell.2021.707572].