| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGGCCAACUCCAGGGAUUCCUUCCACGACAGAAAAACAUACAAGACUC… | 1790 nt | 0.4207 |
The protein encoded by this gene is localized to the nucleus of endothelial cells and is induced by IL-1 and TNF-alpha stimulation. Studies in rat cardiomyocytes suggest that this gene functions as a transcription factor. Interactions between this protein and the sarcomeric proteins myopalladin and titin suggest that it may also be involved in the myofibrillar stretch-sensor system. [provided by RefSeq, Jul 2008]
A study in humans identified the ANKRD1 as significantly downregulated at the RNA level specifically in cardiomyocytes of sudden unexplained death in schizophrenia (SUD-SCZ) cases compared to controls, implicating its role in cardiac contractility and calcium homeostasis [Chen et al. DOI:10.1016/J.Forsciint.2025.112646]. A study in humans demonstrated that the ANKRD1 mRNA was differentially expressed in pericontusional brain tissue following traumatic brain injury, showing down-regulation by 27% in patient T3 and 43% in patient T6 compared to control tissue [Michael et al. DOI:10.1016/j.jocn.2004.11.003].