Basic Information

Symbol
ANKRD1
RNA class
mRNA
Alias
Ankyrin Repeat Domain 1 CARP C-193 CVARP MCARP ALRP Ankyrin Repeat Domain-Containing Protein 1 Ankyrin Repeat Domain 1 (Cardiac Muscle) Cytokine-Inducible Gene C-193 Protein Cytokine-Inducible Nuclear Protein Cardiac Ankyrin Repeat Protein Epididymis Secretory Sperm Binding Protein Liver Ankyrin Repeat Domain 1 BA320F15.2 HA1A2 C193
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Forensic psychiatry evaluation Mechanical injury analysis

MANE select

Transcript ID
NM_014391.3
Sequence length
1790.0 nt
GC content
0.4207

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-482.20 kcal/mol
Thermodynamic ensemble
Free energy: -515.85 kcal/mol
Frequency: 0.0000
Diversity: 601.30
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((...(((((...((((((((((((.......((((.((.((((((((((((((......)))).((((((((.((((..(((.((((((((.((.((..((((((((((.(((((((((((.(((((...))))).)))(((((((((((((......(((((.............)))))(((((..(..((((((((.((((((.((((((..(((...)))....)))).)).....((........)).(((......)))........................(((((((((.(....((((......(((((.......)))))((..((((((((......((((((.........(((((.........)))))(((...)))..............))))))......)))...)))))..))..((((.(((....((..((((((((.((((.....(((((((...)))))))....((((((((((....(((((((.........(((((....))))))))))))...))))))))))...(((((((.((((..((((((..(.((.......)).).)))))).....))))...)))))))((.(((((.((.....))))))))).....(((.((((......(((((.((......)).))))).....)))).))).((((((.(((((.((...(((((.(((((((((((....))).))))).)))))))))).))))).)))))).....(((((....))))).(((((.(..((.....((......((((.(((((((((...((((((((...(((((((..((((((.(....).)))))).)))))))))).))))).))))).....)))).))))......))..))..).)))))))))))))))))..))...))).))))....(((...((((((((((((..((......))..))))((...)).....))))))))...)))..............(((.((.(((((.(((((.((((.(((...))).....(((.(((.(((((.........))))).))).))).)))).)))))))))).)).)))))))).))))))))).........)))))).))))))))..)..))))).......))))))...)))))))......)))))))).)))))....)))))..)).))(((..(((........)))..)))..)))))))).)))..))))....((.....)))))))))).((((((((...((((((((((.(((.(((...((......))...))).))).).)))))))))..(((((((((..(((((((((((..((((((((((((.......)))))))))))).....)))))))...))))..)))..)))))).....))))))))..(((((((.(((((((((((....(((((((((((....((((.......)))).....((((((............)))))))))))))))))...))))))))))).))))))).(.((((.....)))).)...))))).))..))).)).)))).........)).)))))))))).......)))))...(((((..(((.((((.((.............)).)))).))).)))))((((((.((((((((((........)))))))))))))))).........)))..............
Thermodynamic Ensemble Prediction
.,,(((...(((((,..(((((((((((,.......{{{{.{{.({((((((((((((......}))}.{|||,,,,.,|||..{{{,({{{{{{,..,,,,.,{(({,.{((({{((({((((,,.(((|({((({|...}))}}.||.|||{{,{{{((,{((,(((((.({,,,{||.,||||{||{.|{{{{({...}||}|.|||{.||||||..|||}}}))),)}..||||||....,{,.,......,,.{,({{{,..}|}............,,..........{{,,.,|||.....,||||..,.,.|{{{.....||,,||..,}}},...,}}|......,{((((,,.,{{,..(((((.........))))),||..,)))...{({{(({{{{{{|{|(({,{{{(({{.{,,,,,|}.||||((((,(((,,......||{||||,,|||,.....,((((((...))))))},.,||{{{|{(({{||||,||{{....,,,,.,,(((((....))))),||||||,..,|,},,,{||{...((((((.((((..((((((.{({(,..}}}}.}}...)))))).....))))...)))))))||,|||||,|{.....))))))))),..,)))))}}}|......(((((.((......)).)))))....,||||||}..((({{(,(((((,((,,,(((((.(((((((((((....))},})))).}}})))))}}.}}))).)))))},{{{{({{((,...))))}.,}}}..,,|||,.|{{(({{|{..{|{{,,{{{{{{{(.,,((((({{{...(((((({..((((((.{....}.)))))).)))))))))).))))}.))))}.,..,))))})))).,{{{{{|,,}.,||||}|||||},,}||}}}|..||...})}.}}}.....||{...((((((((((((..((......))..)))){{...}}.....))))))))...}}}..,..{,,,,.,,{(((.((.(((((.{((((.((((.(((...)))....,{{{.(((.(((((.........))))).))).})}.)))).))))}))))).)).)))....}}}})})))})},.))))),))}))},,))))))}..}}})))))),,)),...}}},.,,,,,.,,,,,||,|||||}}||,|||.,,,.||||}.,.||,{{((,..|||}|,}||||||||,,|||,|||||}||||}|,|||||||,,{{......|||}}|||..|||||||||,|}}|.|||.{|||||..{|,,,||..,,},}}...((((..((((((.(((.(((.(((((((((..(((((((((((..((((((((((((.......)))))))))))).....)))))))}..})))..)))..)))))).))).))).))))))....)))).{{{{{({{{{..,.||||||{{{{|,...{{||.......)))),,,,,((((({............))))))))}}}}}}}}}.,,,}}}}}}}}||{{{{{{{{.{.((((.....)))).,..))))))))),.))).)),)}))...},....)),)))))}))}),,,....})))}...{((((..{{{.,{{{.{{{,.....,,))}.}),)))),))}.}}))}{{((((.((((((((((........)))))))))))))))}.........)))..............

Transcripts

ID Sequence Length GC content
AGGGCCAACUCCAGGGAUUCCUUCCACGACAGAAAAACAUACAAGACUC… 1790 nt 0.4207
Summary

The protein encoded by this gene is localized to the nucleus of endothelial cells and is induced by IL-1 and TNF-alpha stimulation. Studies in rat cardiomyocytes suggest that this gene functions as a transcription factor. Interactions between this protein and the sarcomeric proteins myopalladin and titin suggest that it may also be involved in the myofibrillar stretch-sensor system. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the ANKRD1 as significantly downregulated at the RNA level specifically in cardiomyocytes of sudden unexplained death in schizophrenia (SUD-SCZ) cases compared to controls, implicating its role in cardiac contractility and calcium homeostasis [Chen et al. DOI:10.1016/J.Forsciint.2025.112646]. A study in humans demonstrated that the ANKRD1 mRNA was differentially expressed in pericontusional brain tissue following traumatic brain injury, showing down-regulation by 27% in patient T3 and 43% in patient T6 compared to control tissue [Michael et al. DOI:10.1016/j.jocn.2004.11.003].