| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCUGCCCUCGAGCCCACCGGGAACGAAAGAGAAGCUCUAUCUCCCCU… | 1127 nt | 0.4250 | |
| AUUCUGCCCUCGAGCCCACCGGGAACGAAAGAGAAGCUCUAUCUCCCCU… | 936 nt | 0.3942 | |
| AUUCUGCCCUCGAGCCCACCGGGAACGAAAGAGAAGCUCUAUCUCCCCU… | 1058 nt | 0.4083 |
This gene encodes a cytokine that functions in inflammation and the maturation of B cells. In addition, the encoded protein has been shown to be an endogenous pyrogen capable of inducing fever in people with autoimmune diseases or infections. The protein is primarily produced at sites of acute and chronic inflammation, where it is secreted into the serum and induces a transcriptional inflammatory response through interleukin 6 receptor, alpha. The functioning of this gene is implicated in a wide variety of inflammation-associated disease states, including suspectibility to diabetes mellitus and systemic juvenile rheumatoid arthritis. Elevated levels of the encoded protein have been found in virus infections, including COVID-19 (disease caused by SARS-CoV-2). [provided by RefSeq, Aug 2020] CIViC Summary for IL6 Gene
A study in rats demonstrated that the IL6 mRNA exhibited bimodal expression peaks at 4 and 20 hours following experimental fat embolization via triolein injection or femoral fracture, with its expression being significantly suppressed at 16 hours, and a weak correlation was observed between its mRNA levels and fat embolism severity in affected individuals [Kuwata DOI:10.1016/J.Legalmed.2024.102531]. In a separate investigation, UVB-induced inflammation in human and rat skin resulted in a significant up-regulation of the IL6 gene, with fold changes of 89.6 and 88.4 respectively, identifying it as a key inflammatory mediator at the peak of hyperalgesia [Dawes et al. DOI:10.1371/journal.pone.0093338]. A study in pigs demonstrated that in a long-term trauma model, the induction of hypothermia resulted in a significantly prolonged increase in local IL-6 levels within fracture hematoma at 24 and 48 hours compared to normothermic controls [Horst et al. DOI:10.1371/journal.pone.0154788].