Basic Information

Symbol
INHBA
RNA class
mRNA
Alias
Inhibin Subunit Beta A Inhibin, Beta A (Activin A, Activin AB Alpha Polypeptide) Erythroid Differentiation Protein Inhibin Beta A Chain Activin Beta-A Chain EDF Follicle-Stimulating Hormone-Releasing Protein Erythroid Differentiation Factor Inhibin Beta A Subunit FSH-Releasing Protein Inhibin, Beta A Inhibin, Beta-1 FRP
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Other applications

MANE select

Transcript ID
NM_002192.4
Sequence length
6046.0 nt
GC content
0.3915

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1668.05 kcal/mol
Thermodynamic ensemble
Free energy: -1785.80 kcal/mol
Frequency: 0.0000
Diversity: 1483.65
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.............((((...(((((((.....)))))))....))))............((((.((((((((.(.(((.((((((.....))).)))....(((......................................))).(((.(.((........)).).))).((((((.((((...(...((((((...))))))((((.((.(((((..(((((.(((((..(((((((....)).))).))..))))).)))))))))).)))))).......)...)))).)).)))).((((.((.(((((........)))))))...))))(((((((....((((((((((((.....(((((......((((...(((.(((((((....)))))).....((((((.......))).))).(((....)))..(((((.(.((.(((.((.....((((....(((..((((((......)))))).))).....))))....)).))))).).))))).).)))....))))....)))))....)))))))........................(((.((((((((......)))).)))))))(((((.(((((((...(((((.((((.(.....(((....)))(((((....))))).).)))).))))).......))))))).)))))............))))))))))))...(((....)))....))).))))))))).))))....(((((((((((....((((....))))....(((((((((((....((((...(((.(..(..(((((((((.(((((((((..........(((..((((....))))..))).....(((((((((..(((((((((........))))))))).))))).)))).((((((((..(((.((...((((((((((.((((((......))))))(((((((((......(((((...((.....((.....((((..((.((((((.........(((((.(((((..((((((.((((.(((.((((((...(((.((((((....((((((.(((((((((.(((((((((..(((....)))..)).....(((((....)))))))))))).))))))).)).)))))).......(((((.....)))))((((((.......))))))...)))))).(((((.....))))).(.(((((((((......))))........))))).).(((((...((......)).))))).)))...))))))))))))).)).))..))..)))))..))....(((....))).))).....)))))).))..))))...))...))...))))))))))))))..(((((((((((((.(((.((.((((((((.......))))))))...)).))).(((.....))).))))))....))))))))))))))).))...)))))))))))))..))))))))).))))(((((.....(((.(((.(((((((....((((((((...((((((.......))))))..)))))))).((((((((((((((...((((((((((...(((((.(((((..(..(((((((.........(((((.((((((((.(((((.......(((.....)))(((((....)).))).........(((.(((((((((.(((((((......(((((..(((((((((((....))))).((((((((...))))).)))......((((...........))))..(((((((((......))))))))).........(((((((((((....)))))))))))......(((((..(((((....))..))).)))))))))))..)))))......))))))).))))))).))...))).....((.(((.((((((...........(((((((......)))))))..........)))))).))).)).........(((((.((((((((.......(((........))).......))).))))).))))).))))))))))))).)))))...........((((((.((((.(((((((((((((.......(((((((((((((((.((((((................(((..((((.((....((((((..((((...(((.(((((((((....((((((...))).))).....)))...))))))....((((((((......))))))))...((((((((............))))))))((((((........)))))).((((.(((((((((((.....))))..))))))))))).((((((((...((((((.((.((((((((..................((((((...))))))..(((((.....((((((((((..(((.((.......)).))).)))))))))).)))))....((((.(((.....)))))))..)))))))).)).)))))).)))))))).((((((((.....(((((..(((((.......))))).))))).....))))))))....((((((((.(((((.((((.(((....))).))))..))))).))))..))))))).))))...))))))....)).))))..)))..(((((((..((((((.((((.((((((((....)).)))))).((((((((((((((.(((...(((((((((((((.......)))))...))))))))((((........))))..)))..)))))...)))))))))(((((...((((.....((((((((((((((((((....(((((....))))).....)))))))))))))))))))))))))))((((((((........((((..(((((..(((((((((((.....)))))).)))))..))))).)))).....(((((.((((((.((((((..((((.......(((((((((((..(((((((((...(.(((((.........))))).).....))))))...))).)))))).....))))))))).))))))...((((((((.........(((((..........(((..(((((((.((((((((((......((((((.....((((.((((.........((((((.(((....(((((((((((((((...(((((((...((((((((((..((((((.(((((((((((.(((((((..(.......)..))))))))))))))).....)))..))))))))))).)))))....(((((((.((....(((((((((((((((((..((((..(((((((((.((((....((((((((.((...(((.((((.(((((((.(((....(((((.(((((((((((((((..(((.((((..(((((.......)))))...)))).))).......(((((......(((((........)))))......))))).......)))))))))))).......(((((((((((((....((.((((((.....((((......)))).....)))))).)).((((((........))))))..)))))))).))))).........(((....((((((((....))))))))..)))..(((..((((.....((..(((((((((...((((((....))))))........(((((((....))))))))))))))))..)).....))))..))).((((((......)))))).(((((((((((.(((..(.((((((.(((............(((.(((((.((((((((((((...((((((...))))))((((((.(((((..((((((((((((..((((....(((((.....((((.....))))))))).))))))).((((((((((((...............))))))))))))....(((......))).(((((((((....)))).)))))....)))))))))..)))))..))))))........))))))))..))))))))).))).(((........)))...(((((((((((.((((((((.......))))).....(((((.(((.(.....(((((...(((..(((....)))....))).....)))))).))).)))))(((((....)))))........)))...))).))))))))((((...(((((((...((((((...................(((.........)))...(((...))).....)))))).)))))))((((.......))))...((((((((((((((((((((((......))))))).))))....((((((.((((((.....)))))).))))))..((((........))))(((((.......)))))..(((((((((..((.......))..)))))))))........)))))))))))..(((((((..(((((((.(((.............)))))))))).......(((......)))))))))).....)))).(((((((.........)))))))............)))..)))))).)..))).)))))))))))...)))..)))))...)))..))))))).))))))))).)))))))).((((.(((.(((.(((............)))..........(((((...)))))..))).))))))))))).))))))))).))))..((((.....))))........)))))).......))))))))))).....)))))))))))))))).)))))))))))))))....))).)))))).......(((((((((((........((((((........((((........))))........))))))....((((((((((........))))))))))..........)))))))))))......((((....)))).....(((.((((.((....)))))).))).......((((((.........(((((.((........)).)))))...)))))).((....))....((((((.........)))))).......)))).))))....))))))..........)))))))))).))))).))..)))..)))))(((((((.....))))))).......))))))))...)))))))))))))))))))(((.......))).(((((.((((.((....)).))))..)))))...)))).))))))..))))))).........((((((((........)))))))))))))).))))))))).........(((((...)))))(((((..(((((.(((.....))).)))))...)))))....(((((((((((...)))))))))))..........((..(((...)))...))..((((((...))))))......))))))....)))))))))))))))))))))))....)))))))..)..)))))))))))))))))))).))))))))))))))....(((.(((((.........(((((((((((((.((..(((((.......(((((.....((((((((.((((.((((((((....)))))((((..(((.....)))..))))..((((...(((((((((...(((...))).)))))))))..)))).))).)))).))))))))...)))))((((((.....))))))...))))))))))))))))..)))).........))))).)))...)))))))))).)))..)))))..)))))..)..).)))...)))))))))))))))................)))))..))).))).
Thermodynamic Ensemble Prediction
,{,,{.(({,...((((..,(((((((.....))))))).,..))))........,,,.((((.((((((((.(.(((.({{,,{.....|||.||}....|,|...{,.................................|||.({{.{.{{........|}.}.}}}.((((((.({{{..,(...((((({...})))))((((.((.(((((..(((({.(((((..(((((((....)).))).))..))))).}))))))))).))))))...,,......))))})).)))}.||,|.|{.(((((.,.....,)))))}(((((((((((((((....((((((((((((.....(((((.,{{..{((({.,(((.,{{||||.,,,))}}}|,,,..((({{{.......})),)}).|||,.....}..{((((,(.((.(((.(({{.,.{{{,.,.}||}((((((((......)))))),)).,,...))))....))}))))}.}.})))).),)})....,}})}.,,))))),...))))))).....,,...,..,||.,{{.,..((,|(((({{({,.....}))).)))))))(((((.(((((((...{({((,((((.(.....{{(,,..}}}(((((....))))).,.)))),))})),},,...))))))).))))).....,,,,,..))))))))))))..))))...})))....))).))))))))).))))..,,((.{((,,,||}..,||||...{||||....((((((((((({{,.,{{{...(((.(..(..((((({(((.(((((((((.......,.,(((..((((....))))..))},}...(((((((((..(((((((((........))))))))).))))).)))).((((((((..(((.((...((((((((((.((((((......))))))(((((((({.....,(((((...((.....({.....((((..((.((((({.........{({((.(((({.,((((({.((((,(((.((((((...(((((((..{....((((((.(((((((((.(((((((((..(((....)))..)).....(((((....)))))))))))).))))))).)).))))))..,..}}))|(({{({..({({({{{{,{({{{{.,..,,,....}))))}||,}))})..)).))}).(((((((((......))))........)))))...(((((...((......)).))))).}))...))))))))))))),)),)},..}..))}))..}).)}.|||,...}}},{{....}))))))).))..))))...))...))...))))))))))))))..(((((({(((((({(,{.,,.((((((((.......))))))))...),}))),{((.....}},.},))},})}.,)))))))))))))).))..}),)))))))))))..))))))))).)))|(((((.....(((.{({((((((((..,,((((((({...((((((......,))))))..)))))))).{(((((((((((((...((((((({,,,{((((((((((((..{..(((((({...,.,{..(((((.((((((((.(((({.......(((,...{|}}(((((....)),,))..||.....(((.(((((((((.(((((((.,....(((((..(((((((((((....))))}.({((((((...}))))},)}......((((.,........,})))}.(((((((((......))))))))).........(((((((((((....)))))))))))......(({((..({{,,....,}..})).)))))))))))..)))))....}.))))))).))))))).)),..)))....|{,,(((,((((((...........(((((({......))))))}.........,,}}},,.,.,.,..},}}},|}|||{|,|{{{{.,,.......{{(.{,...,,}}}........,,.))))).,}))).})))))))))))).)))))..},.....,.(((((((((((((((((((((((({....,,,{((({,{((((((((.((((({................(((,.((((.((....((((((..((((...(((((((((((((....((((((...))))}}).....)))...)))))}....((((((((.....,))))))))...((((((((............))))))))((((((........)))))).((((.(((((((((((.....))))..))))))))))).((((((((...((((((.((.((((((((..........{{,.....((((({...)))))}..{{(({.,({.(((((((,((,.{(({,,....,,})),,))}))))})))}||))}}}....((((.(((.....)))))))..)))))))).)).)))))).)))))))),((((((((.....(((((..(((((....}}})),}}.))))).....)))))))).|.,,.,{((((.(((((.((((.{{{....}}}.))))..))))).)))},}}}})))).)))).,.))))))....)).)))).,)))..(((((((..((((((.((((.{(((((((....}).)))))|.,{{{{{{({{{(((,{{{...,((((((((((((.......}}))),..}))))))|((({.,,..,,}})))|{|||{.,,,,)}}}))}}},,},|((({,...,||{{,..((((((((((((((((({,{{.(((((....)))))...}})))))))))))))))))).}||,,||||||||,,........,((((,.((({(,,(({((((((((..,..}}}}}}.}}})).,))}||,||}}...}}}}}|,.,,,|||}||||||}}|,||..,||,,,{|||{{{.(((((({({(((.(((((((....,({{{...(({.{(({{...||{((({.,{||,}},}}},.,}})}}..|||{{{.|,,,...,.|,||||.,,...}})))}}}..,}}}})))))))))}(((((.((((((((((,,....((((((.....((((.(({,..,|,......,{((((({.(((({{{(,{{{{{,.((({..(((((((((((((((((..,{{{((({.((((((((((,,(((((((.,{.......}..))))))))))))))).....)))..)))}}||{({{(((.(((((.(((((((.{{....(((((((((((((((((..((((..(((((((((.(({.....((((((((.((...(((.((((.(((((((.,{(....{{{{{.,,,((((((((((((..(((.((({{,({(((.......,}}}},,,|})).)))....,{{(((((.{{,..,((((,{{,....}}))))})}}.,}},,.......)))))))))))).......(((((((((((((....((.((((((.....((((......)))).....)))))).)).((((((........))))))..)))))))))))}))...,,,,..(((..,.((((((((....))))))))..)))..,,,..(((({{.{{(({{,,(((((((.{(((({{{{{{..,|{(((({{..{{(((((((....})))))))),||||||..}|{{{{{|,||{{|||..,,,,..}}}}})),},)}}|||,,,{{{{{(((,{,{(({{{{,({,............(({,({{{.,((({((((({{,..{((((((...}))))}|{{{{{.(((((..((({{((({({{..{(((.{{.(((((,....((({....,)))))))}),}}}|||)|{(((((((((((...............))))))))))}|,,,,{{{{,,,,|,,,.(((((((((....))))},))))....))))))))}..}}|||,,||}}}|,.....,,|}}}}}}|..}}}}}}}}}.))).|{|,.,,,,..,},...{((((((({((.((((((((.......)))))....,(((((.(((.{,....(((((,..(((.,,{{....,,,...,))).,},.}))))).))).)))))|((((....))))}........)))...))).)))))))){{||,,,(||||{|...{{|{|{,,...|,|,....,,.,,,{{{..,....,,)))...||{,,.}}......)))))).}}}})))|||||....,})))),}.||||||||||}}.,...}}}||}}}}}}.,},,})})}.)}}}}}}.}}|}|}.}}}}}},|||||,..((((.,,(((((...,....}}}}}...|}}}.,,,,,,}},,||,{(((((..((.......))..))))))|||{|{,..,,||||||||,,,.,|||||||,.(((((((.(((.............)))))))))).......(((,.....}}}}}})))),.,}})))).{((((((.........))))))).,..,.,,,,,,|}},,}},})).}.,)))}))}}},}}))},,,))),,)}))),,.)))..))))))).))))))))).)))))))),((({.{{,.{{{.(((,...........}}}..........{{||{.,,})))}..})}.}}})))))))).))))))))).))))..((((.....))))........)))))).......})))))))))).....}}))))))))))))..)))))}|}||((({{...,,,..}}}})}},,.,,,,}},...,,......)))))))))))))))))..((((........)))){(((((.(((((......((((((((((........))))))))))........)))))))))))))}},{|,((((....)))).,,......((({,((....)))))){|||{{...,,((((((,........{({{{.,,........,,.))))}.,,),)))).......,))}}}},,,{,.......,.}}))))}}}}}}}))),.))))....))))))..........}))))))))).))))).|,..}||||}}}}}||||({{...,.)}}}}|}..,},}}))}}}|||,|,}},}},}}})},))}})))}}}}}},...||||{{{{|.|||||{||||,,,.}}},..)))))},,)))).))))))..)))))))........,((((((((........)))))))))))))).)))))))))..,}},}}.(((((...)))))(((((..(((((.{((.....))}.)))))...))))){,,.(((((((((((...))))))))))),,,.......(({{(((..,|,|{{{|...((((({...)))))).,},,,))}))).}},))))))))))))))))))))))).,..}))))))..}..)))))))))))))))))))).)))))))))))))}{{{,,{,.{||||...,,.,,.{(((({((((({{{((..{((((.......(((((.{,..((((((((.((((.(((((({(,...}}}||((((,.({(..,,,|||,,||||,.{{{{...{{{{|||||...|||,,,,)}.)}))))))).,)))}}))).)))).)))))))).,.)))))((((((.....))))))...})))})))))))))}|..}))),,,,}}..,)}))),}}},..,))))))))).)))..))))),.)))))..)..).)))...})))))))))))))).,..............))))),))),,))).

Transcripts

ID Sequence Length GC content
ACAGUGCCAAUACCAUGAAGAGGAGCUCAGACAGCUCUUACCACAUGAU… 6046 nt 0.3915
Summary

This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate a subunit of the dimeric activin and inhibin protein complexes. These complexes activate and inhibit, respectively, follicle stimulating hormone secretion from the pituitary gland. The encoded protein also plays a role in eye, tooth and testis development. Elevated expression of this gene may be associated with cancer cachexia in human patients. [provided by RefSeq, Aug 2016]

Forensic Context

A study in rhesus macaques identified the INHBA as a differentially expressed gene upregulated in animals with hypertrophic cardiomyopathy and sudden cardiac death, and it was also a shared upregulated gene between this primate model and pediatric human HCM [Rivas et al. DOI:10.1038/s41598-024-82770-4]. In human ovarian cancer, integrative multi-omics analysis found the INHBA to be a metastasis-associated gene included in the gene expression dimension of a multi-dimensional module linked to the TGF-b signaling pathway [Zhang et al. DOI:10.1093/nar/gks725].