Basic Information

Symbol
INHBB
RNA class
mRNA
Alias
Inhibin Subunit Beta B Inhibin Beta B Chain Activin Beta-B Chain Inhibin, Beta B (Activin AB Beta Polypeptide) Activin AB Beta Polypeptide Inhibin Beta B Subunit Inhibin, Beta B Inhibin, Beta-2
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Other applications

MANE select

Transcript ID
NM_002193.4
Sequence length
3206.0 nt
GC content
0.5667

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1262.90 kcal/mol
Thermodynamic ensemble
Free energy: -1321.36 kcal/mol
Frequency: 0.0000
Diversity: 747.12
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((...((((((((((((....))))(((((((..(((((((((((((......((.(((((.((((..((((...)))))))).)))))))...))))))))))))).(((((((.(.(((((((((..(((((.((..((((((..(((((..(((.((((((..(((((((.((...(((((((((....)))))))))..(((.(((........))).)))(((.(((...))).)))..(((((.(((.(((......)))))).))))))).)))))))..))))))(((((((..((((.(((((.((((((((((......(((...((..(((........))).)).)))....))))))))))....))))).)))).))))))).))).)).)))..)))))).)))))))..)))))..)))).)))))))).)))))))...(((..(((((..................))))))))(((((((((((((((((((((((((..(((.((((...(((((((.(((((...((..((((.(((...))).))))..))((((..((((...))))...))))...(((((.((((((.((((.((.(((((((...((((((((((((((.(((.((((...........((.(((((((((((..((((((((...((((((((((((((((..((...(((......)))))..)))))))((......)).(((((((((((((((((((..(((((((.(((.(((.((......)).)))(((((......))))).....))).)))((((((((..((((.((.(.(((((.(...(((((((((((.((......)))))))).)))))).)))))).))))))))))))))..))))))))))))))))))......)))))((.....)).((((((....)))))))))))))))...))))))))..(((.((((...((((((.((((((......(((.......)))......))))))((((....))))(((((((((((.((((((((((((..((((((((((((.((((.(((((((((((......))))))).))(((((....))))).....((......)).((((((((((..((((.(((.....(((((((.((((......(((((.((....)).)))))...))))))))))).....)).).))).)..))))))))))(((.((((.(........))))).))))))))).))))...))).)))))..))))..)))))))).)))(((((((......)))))))....))))))))((......)).((((((.((((((((((((.(((((((((......)))).).)))))))))))))))).))))))...))))))....))))..))).....(((.(((((((................(((...(((((...((...((((..((((((((((...((...............))......)))...)))))))........)))).))...)))))...))).)))))))..))).(((((((((.....))).)))))).)))).).)))))).)))))).))).)))))))))))).((..........)).....((((((((.(((((.(..(((.(((((((((((.(.......(((.((((((...(.(.((((...))))..).)...)))))).))))))))))))))).((((((.......)))))))))..).))))).)))((((((((((..((..(.....)..)).))).)))))))..)))))...)).))))))).)).)))).......((((((((.((((((....(((((((.((((((..((.(((((.............))))).)).)))))).)))))))...((....)).))))).).)))))))))))))).)))))))))))))))))))))......((((...(((((((........)))))))...))))(((((..(((((....)))))...))))).((((((.(((..((.(((..((((.((....)).))))..))).))..)))..))))))....((((..(((((.((((((...((((.(((((((((.(..((......))..).)).))))))).))))...).))))).)).)))..))))........))).))))))))))..........((((((((..(((.....))))))))))))))))))...(((((((((.(((.....))).....(((((((((((..((.((((((.(.((((((..(((.((..((((((((....((.....((((.(((.((((..(((((....).))))))))..))).))))....))..)))))))).))))))))))).).).))))).))....((((((.((...(((((..((((((.((.((...(((((.((((((((((((.......))))))..........).))))).))))).)).))))))))((..(((((((((((.....((((......))))....)).)))))))))..))..............((((((((((((((((((.......))))))).((((((((..(((((((((.((.((((.(((.((.(((((((......((((....((((((.......))))))..))))..................((((((......))))))..)).))))).)).)))...(((((((.....(((.((((..........)))))))..)))).))).)))).)))))))))))..))))))))((((((((((....)))....))))))).......)))))))))))..))))).)).))))))...........((((((((.......((..(((........)))..)).......))))))))........)))))))))))................)))))))))....)))))))).....................((((((...((((((((((.....))))..((((......)))))))))).))))))...)).))))))))).
Thermodynamic Ensemble Prediction
.((({{,{((((((,((({.,,,||||((((((((((.((((..(((,(({((......,)).}))))).,..)))).))))))},))))))|{{((((((.(((((.(((((((((.{.(((((((((..(((((.((..((((((..(((((..(((.((((((..(((((((.{(...(((((((((....))))))))).,(((.(((........))).)))|{(.(({...}}},}||.,(((({.((||(((......)))))).})))))).)))))))..))))))(((((((..((((.(((((.{(((((((((,.,,........((..{{{,,,.....))),}}..))),}.)))))))))}....))))).)))).))))))).))).)).)))..)))))).)})))))..))))}..)))).})))))))})).))))).)))},))))},}}}....,||........,.,,,)))))).(((((((((((((((((((((((((((((((...(((((((((((((......{{...||...{(((((({(((((((..((...((((.|((((((((((...((.(((((....(((((.....)))))....))))).}).,.))))).)))))...,..,)))).)).)))))))),.})))))))))....)))))))))).))))))))))..,((.,,,..}))}},...(((((((((((.(((((((,.((((((((((((((..((({(((.(((,({,.,{...,,..,.|},(((((......))))),....))).)))((((((((..((((.((.(.(((((.(,..{((((((((({,((......)))))))).)))))).)))))).))))))))))))))..}))))))))))))))))),,{{(((((((((.(((..((((((((((((((...(((((...((((((((((((.....))).)))..(((((..{(,(((,.,{{{(((,....{{|||......))))).((((....)))){((({{{((((.((((((((((((..(((((,(((((,.(({(,{,,,{({({{{...,,.|||||,,,{((((((....)))))},}}}||},..,.||.((((((((((..((({.,((.,,,,{{{((((.((((......(((((.((....)).)))))...))))))))))),.,,.},.,.})),),.))))))))))(((.((({.{.......,})))).))))))))))))))...)))))))))..))))}.}))))))).))}(((((((......)))))))...,))))))))),,..))))).{(((((.((((((((((((.,(({{((((......)))).}.}}},)))))))))))).)))))}.....})))}}....)))))(((....)))...|{.{{{.............}}}},...(((((.,.((...((((..((((((((((..........},,.,,....}}......}},...)))))))........)))).))...)))))...)))))).))).))))).(((((((((.....))).))))))........))).))))))).,,....}))})))))))|(((((((((....((((((((.(({(((.(((((.(..(((.(((((((((((.........(({.{{||,(.,.{{{.{{(({{{||||..,.},,,)))))).}}))))))))))))).((((((.......)))))))))..).))))).)))((((((((((.{((.,,.....}.})).))),}))))))...{{(((({,,.,,(((((...)))))...,.,.,,|,,.,}))}}},.....(((((((.(((({{.,||||(({{........})}.})})))})}.)))))).)))))}).}}.))).)))))))))))))),...)))))))))))..))))).}}.((((((((..,..{((..{(((({{{((.,,,.,..}}})))}.}}}}}}(((((..(((((....)))))...))))).{(((((.(((..((.(((..((((.({....}}.))))..))).))..)))..)))))},})))..)}}..},,})))))}...(((({...)))))((((((((((((((((.((((((({.....(((((.....)))))........{((((.{{....(((((((((..((({.,{{,...(((((((({..((({....)))))))))))){{{{|{{{{,,(({,..|,,|||..||}|||||.,.}},|((((.,,||{{(({.((......)).)))))}.)||}}.,{{{|{((((((.....)))))),,.......,)))))}))))..))).))))))).)))))))))))))))(((((((((..(((....)))(((.{{((((,,{.....((....))...,.,,,)))))).)))..(((((.((((({((((((.......))))))..........).))))).))))))))..)))))).,,..((((((((({{.....((((......))))....)).)))))))))..}|..,,,,,,...,{{{{{.{.{(((.(((((((.......))))))).)))}.}}}}}}}.,|{{{,{((((((,{{{,....))))))))))...((((....{(((({.......))))}),.))))..................((((((......))))))..........{(((..((.....)))))}))))))))))))).........,..))))))))))))))((((((((.{(((((..{(.((((.{({....,.)).)))))))))))},{(({,.,((((((((...}}}}}}))|....{{{{.{......)))))..{(((((((,,....,((..(({.......,)))..}}...},..)))))))),,,,.....))))))))....{{{{.....,,.}}}}.....{{{{{{,.{{{{....}}.,}}}}},.........{{{{{{...(((((,((({.....)))},{((((|....})))))))))}.)}}}}}......})))),))).

Transcripts

ID Sequence Length GC content
CGGCUCGACUCGGCUCGCCUCGCGGCGGGCGCCCUCGUCGCCAGCGGCG… 3206 nt 0.5667
Summary

This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate a subunit of the dimeric activin and inhibin protein complexes. These complexes activate and inhibit, respectively, follicle stimulating hormone secretion from the pituitary gland. Polymorphisms near this gene are associated with pre-eclampsia in female human patients. [provided by RefSeq, Aug 2016]

Forensic Context

A study in rhesus macaques identified the INHBB as a differentially expressed gene upregulated in left ventricular tissue from animals with hypertrophic cardiomyopathy and sudden cardiac death, indicating its association with this cardiac disease process [Rivas et al. DOI:10.1038/s41598-024-82770-4]. In human ovarian cancer, integrative multi-omics analysis found the INHBB to be part of a TGF-beta signaling pathway module, where its gene expression was coordinately regulated with specific DNA methylation markers and microRNAs, revealing its role in a perturbed oncogenic network [Zhang et al. DOI:10.1093/nar/gks725].