Basic Information

Symbol
IPO5
RNA class
mRNA
Alias
Importin 5 RANBP5 KPNB3 IMB3 PSE1 Karyopherin (Importin) Beta 3 Kap Beta3 Import Receptor Importin Subunit Beta-3 RAN Binding Protein 5 Ran-Binding Protein 5 Karyopherin Beta-3 Importin-5 MGC2068 Imp5 PSE1 Homolog (S. Cerevisiae) Ran_GTP Binding Protein 5 Importin Beta-3 Subunit PSE1 Homolog RanBP5
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_002271.6
Sequence length
6002.0 nt
GC content
0.4099

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1655.40 kcal/mol
Thermodynamic ensemble
Free energy: -1772.63 kcal/mol
Frequency: 0.0000
Diversity: 1194.92
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((....))).(((.((((((.((((.(((..((((..(((((.((((((....)))))).)))))..))))))))).......((((((((..((((((((((((((...(((....)))........((((....))))...(((((((......))).)))).(((((((......)))))))...((((............))))..........((((((((..((((....))))..))(((((((............))))))).((....)).((...(((((...(((.((((.((((...((.(((((((((((((((.((......((((((..(((((((.........((((...(((................)))....))))(((((......)))))...(((((((((((((((((.(((.((.((((((((((.(((((((....)).)))))((((..(((((.(((.(((((((..((((((.(.......).)))))).))))).....)).))))))))))))......((((.((((.((((((((((((((((.....((((....(((((((((((..........((((((((((((((((((((((...(((((...))))).....((((((((((...((((....))))..))))))))))..))))))))....)))))))))))..))).........)))))).....)))))....))))))))))))..))).))))).)))).))))...((((......)))).....(((.((((((((((.((((........))))...(((((......)))))((((((..((((((((.(..((((((...(((..(((.(.(((((((((.((((((((((..((((((....))))))..........((..((.(((..((((((((((.......))))))))))..)))))..)).(((.........)))((((((..(((((((.((((((((.((((((.......((((((((.(((((((.(((...((((...)))).(((((.....((((((((((..((((((((..((((..........(((((....(((.((((((...((((((.......))))))...........)))))).))).....)))))............))).)..)))))))).....))))))))))..)))))..(((((((..((((((((((((.(((((((((((......)))))))))...(((.(((.........((....)).......)))))).(((((..(((((..(((((((((..(((((..(((((((..((((..(((.(((.(((.((...((((((((.((((....((((..(((((......)))))..))))...))))))))..))))...))..)))..))).))).....))))..)).))))))))))..))))))))).))))))))))........((((((((..(((..(((((((...)))))))))).((((((.((((((((((((..(((((((((((.((((((((((((((((((....((((...))))..........(((((.((((.(((((........((((((((((.....((((.((((((...)))......(((((...)))))))).))))....))))))))))....))))).)))).)))))......(((.(((((....(((...(((..(((.(((((.............))))).))).))).)))))))).)))......))))....((((((.....)))))).((((((((.((((.....(((.((....)).)))))))........((((((((...((((((.((((.((((((.(((((((....))))))).)))........(((....((((..(((.(((((((.(((((((((((((((((((((........)))))........((((...((.(((..(((..(((((((((((((((((((..((((((((.((((((.((((..(((((((((....)))).)))))))))...))))))))..(((((.(((((..(((....................))).))))).)))))....((((((..((.((((((.((((((((........((((..................)))).)))))))....).)))))))).)))))).......))))))..)))(((((...((((....((((....))))..))))..))))))))))))))).)))))).)))..))).))..)))).((.(((((.((..((((.((((....)))).).))).)).))))).))...(((((((.((((.(((((...)))))..)))).))))))).......((((((((((.....))))..(((((....((((((((..........(((((...((((((((((((...(((.((.(......).))))).)))))..))))))))))))))))))))....))))).....((((((..(...(((((........)))))..)..))))))...............((((.((((......))))...))))......((((((((.((((((((((((......((((((......))))))......))).)).......(((((((.((((.....(((...)))....))))...))))))).......))))))).))))))))(((......))).))))))...........))))))))).))))))).))...))))).)))..)))).))).................))))))).)))))).....((((((........)))).)).)))))))))))))))).))).)))))))))))..))))))..(((((.(((...((((((.((.(((....)))..))...))))))....(.(((((((((((((.(.(((((..(((..((((.(((((....(((..........)))))).)).)))))))..)).))).).))))))))........))))).)..))))))))((....))...((((.....))))))))))))))))))))))))))))).))))))............((((((((.(((((((((((((.....))..)))))))))))..((.((((.((((.((((((..........((..(((((.....((((...))))....))))).))......((((((((...((.......))...))))))))..((((.(........).)))).)))))).)))).....)))).))....(((((((((..........))))))))))))))))).((...)).((((((....)))))).((((.(((...(((......)))...)))))))................((((((.(((..........(((((((((((((.......)))).)))))))))))))))))))).)))))))))))).))))))).((.....))...))).)))).)))))))))))....((.(((((((.(((.((((..(((....)))..)))).)))))))))))).(((((((((.....(((((.((.(((((((.(((((....(((.(((........)))...)))..))))).((((.((((((.((.....)).)))))).))))))))))).))))))).....)))))))..))((((((((((....)))))......)))))(((((((((....(((..((((((((((((.((((...(((.((((((..((....)).)))))).))).......)))).))..((((......))))(((((.((((..((.(((((..((((((((...(((.((((((..(((.(((((....)))))))).....)))))))))((..(((((((....))))))).)).............))))))))..))))).))......)))).))))))))))).))))..))))))))))))......)))))).))))....(((((((((((..((((((((((.(((((.(((((...)))))..))))))))))..................))))).))))....)))))))..................))))...))))))).)))))).)))).))))))))))))(((....((((......))))...)))..((((((((((((...(((((........((((((.((((((((.....((((((((....))))))))(((((((((((.((((....)))))))..(((....)))((((((((((((.((((.((((((((.((((.....((((....))))......))))..)))))........((((((((...))))))))((((((((((......))))))))))......((((((((((.....)))))))))).........))).))))..(((((((....))))))).(((......))).......))))))))))))............(((.(((((((.....)))))))))).)))))))).......(((((((.....)))))))..))))))))..)))))).....)))))...)).))))))))))........(((.....)))...((((((.....((((.(((((((..................)))))))))))....))))))))).).)))..))).....))))))..).)))....)))))..(((((..(((((.....)))))...))))))))))).)))).)))))).)))..(((((((((((((((((.......((((((((((.(((.((............(((((((((((.(((((((......)))....)))).))))..(((.(((((...))))))))))))))).....(((((....))))))).))).))))))))))........)))))).))))))))))).............((((((........((((.......))))......))))))....))))))).)))...)).))).)))))))..))))))))))((((((((((((.((((...)))).)))...(((((((..((......))..)))))))...))))))))).((((((....))))))((((((.((((..((((.(((((((...((((((..((((((((..(((.....))).(((((((((.(((((((((((((((((((......((......)).......(((((.((......)).))))).))))).)))..........))))))))))).)).))....)))))....))))))))))))))..)))))))))))..)).))))))))...)))))))..)).))))...................(((((.(((....))).)))))...))))))).)))))))).)).)))))).)))).)))..)))))...))((((((.....)))))).....))))))...)))))).)).)))))).)))))))).(((((((((((.(((((..(((...)))...)))))..)))))))))))...((((((((...)))))))).((((......))))..........((((...(((....)))..))))...(((.((((..(((.(((((...((((((........(((((((.........)).)))))......))))))...)))))..)))..))))))).....)).))))))))).
Thermodynamic Ensemble Prediction
....,,({,....,)).(({,((((({.((({.{((.,((((,,(({(({((((((....)))))).)))})},)))))}))),...,,,{(((((((..((((((((((((((...{({..,.}||{,......||||,...}}}|...(((((((......))).)))),|((((((......))))))|{.{(((,...}})}.,..,|,................,{((..{(((....))))..))(((((((............))))))).((....))|||,..(((((...{({.((((.((((...{(.(((((((((((((((.{{...,,.((((((..(((((((........,((((.,.(((.....,..........}}},,}})))}||(({......)))))...(((((((((((((((((.(((.((.((((((((((.(((((((....)).)))))((((..(((((.(((.(((((((..((((({.,..,,,.,}.}}}})).))))).....}}.)))))))}))))......((((.((((.(((({(((((((((((.....,{{{....,,{{,.((((({{.{{,..{{(({(((((((((((((((((((...{((((...))))}.....((((((((((...((((....))))..})))))))))..))))))))....)))))))))))..}},.......,}))..))}..)}))))).......,))))))))..))).})))).)))).))))...((((......))))...,,{((.{(((((((((.((((........))))...(((((......))))){(({{,..{{,{{(((.{..((((((...(((..(((.(.(((((((((.((((((((((..((((((....))))))..........({..(,{(((..((((((((((.......))))))))))..))))}..)),,{{.........)}|((((((..(((((({.((((((((.((((((.......((((((({,(((((((.(((...((({...)))).(((((.....((((((((((..((((((((..,(((.......,,,(((((....(((.((((((..{.{{,.(({,....,,},}}}}}.....,..)))))).))).....))))}............))).}..)))))))).....))))))))))..)))))..(((((((..((((((((((((.(({(((((({,.....,||}}}}}}}.,.{{.,(({.....,...((....)}.,,....}}}}}}.(((((..(((((..(((((((((..(((((..(((((((..((((..(((.(((.(((.((...((((((({,((((....((((..(((((......)))))..))))...))))))))..))))...))..)))..))).))).....))))..)).))))))))))..))))))))).)))))))))).......,((((((((..(((..(((((((...)))))))))).((((((.((((((((((((..(((((((((((.((((((((((((((,{{{....,..,...}},}..........(((((.((((.(((((.,,.....((((((((((.....((((.{{,({,...})}...,,.(((((...))))),,,.))))....))))))))))}}..))))).)))).)))))......(((.(((((....(((...(((..{({.(((((.,,..........))))).))}.))).)))))))).))),,,,..,,,)..,,((((((.....)))))).((((((((.{{({.....(((.((...{|}.,,))}))|.||||..((((((((,,.{(((((.((((.((({((.(((((((....))))))).|}|,,,,....|,|....((((..(((.(((((((.((((((((((((((((({{((,....,,,|}}},...},}}(((((..,((((.......{{(,...}}}..{(((((..((((((((((((((((((.((((..(((((((((....))))},))))))))...}))))).,,.{{{{{.(((({..{{(,{,,,{{.,.,{|,{.,,|.||},||||}.|||||..,.((((((..,{.((((((,((((((({........((((..................)))).})))))).,},),)))))),,.)))))){{,,{{{{{,,||||}}||,|,,.,{{||,..,,))}},}},,})}.,}}))),}}))))),|,||,,..}})),,{{{.(((((((,...((,,,(.{((((.((..((((.((((....)))).).))).)).))))),})}).(((((((.((((.((({{...}}}))..)))).)))))))..((((((((..{((((.....)))),....,..((({{(((((....(((((((((.........)))))))))......)))))))))..}))))))))..,)))))))})}....)))))))))))).)))))}....{(((((..(...{((((........)))))..)..))))))......,........((((.((((......)))}...))))...,{,((((((((.((((((((((({..,.,.((((((......)))))),,,...}}}.,,.......(((((((.((((.....(((...))).,..))))...)))))))..,,,,.})))))).)))))))))},}})))......)))))....,},...)))))))))).))))))).}}..}))))).)))..)))).,,,.,,,.............))))))).)))))}....}||{(((........)))).,..)))))))))))))))).))),}))))))))))..))))))..(((((.(((...((((((.((.(({....})).})}...,})))).,..,.(((((((((((((.(.(((({..{{(..((((,((,{(,,..{{{....,,....})).,},)}.)}))))),,)).))).).))))))))........))))).}..)))))))),|....,}...((((.....))))))))))))))))))))))))))))).)))))),...........((((((((.(((((((((((((.....))..)))))))))))..,{.,,,,.,{{,.{(((((,.........{{..(((((.....{(({...}}))....))))).}},,....((((((((...((......,}....))))))))....,,}|}}}}},,.|,|}||,}}}|||,,,,,,}},.)))},))}...(((((((((({...}}...})))))))))))))))).{{||.}},((((((....)))))).{{{|.||{...|||,,....)))..,))))))}................((((({,(((..........(((((((((((((.......))))))))))))))))))))))))).)))))))))))).))))))).,(,....,}.,,))).)))).)))))))))))....((.(((((((.(((.((((..(((....)))..)))).)))))))))))).({(((((((.,..,(((((.((.(((((((.{((((....(((.{((.{,....,)))...)))..})))}.{(({.{(((((.,{.....,}.)))))).)))}))))))).))))))}.,..,))))))),,|}(((({(((((....)))))...,,}})))}{{{{{(((({,,.(((..((((((((((((.((((..{(((.((((((..,{....,}.)))))).}},....,}.)))).}}..((((......)))){((((.((((..({.(((((..((((((((..,(((.((((((.,((.{(((({....})))))}).....)))))))))|,..(((((((....))))))).,,.............))))))))..))))).)}...,..)))).))))})))))).))))..))))))}))))),}....)))))).)))),,,.(((((((((((..((((((((({{(((((.{((({...}))))..)))))))))).{{{{{,...,}}}}}..})))).))))....))))))).,},..............))))...})))))).)))))),)))).)))))))))))){{(....((((......))))...))}..((((((((((((...(((((.....,..((((((.((((((((..,,,((((((((.,,,|}}|||}},{{{{{{{|||,|{||....,)))))).,(((....}}}|(((((((({{{.{(((.{{{(({((,{{((,.,,,.{{(....,...|||.|}))}),.)))}}.,,}},.{((((((({...})))))))},||||||{{.,,...,|}}},,|||,,....((((((((((.....)))))))))),,,,,...,}}}.)))}..(((((((....))))))).,{{...,|,},}.,}},,.})))))))))}}..,.........{((.(((((({.....)))))))))).)))))))}.......(((((((.....)))))))..))))))))..))))))..},.))))).,.))}}}))))))))......,.(((.....))).,.((((((.....((((.(((((((..................)))))))))))....))))))))).}.)))..))).....)))))).,).)))....,,}}}..(((((..(((((,...,)))))...)))))}}}}},.))))}}})))}.||{{.(((((((((((((((((.......((((((((((.(((.({........,,..(((((((((((.((((,(({,....))}....)))).))))..{{{.(((((...))))),}})))))))..,,.(((((....))))))).))).))))))))))........)))))),}))))))))))..,}}..,.....{{((({........((((.......))))......)))))}....))))))).)))...)).))).))))))),,})))))))))((((((((((((,((({...}))}.})),...((((((..{{...,,,))..}})))))...})))))))).((((((....))))))((((((.((((..((((.(((((((...((((((..((((((((..{({.....}}}.{{{,(((((.(((((((((((((((((((.,,...{(......})...,,..{,{{,.,,,,,...}}.,,))}.})))),}))..........))))))))))).)).))}...})}},....))))))))))))))..)))))))))))..)).))))))))...)))))))..)).))))..|,...............(((((.(({....})}.))))}...}}))))).))))))))}}).)))))).)))).,},..)))))||||||{{{{{},,,}}}}}},...,}}},,,....}))))).))})))))).)))))))}.(((((((((((.(((((..{{{...))}...)))))..)))))))))))...((((((({...)))))))).((((......)))).,,,,{{{,,{{{{.,.{({{||.}||..,,.....{((,({{{..{{{.{{{{|...((((((....|,,,{((({{{,,,,,,...}},))))),.,}}.))))))...))}}),,)))..)})))),.....,}.))))))))).

Transcripts

ID Sequence Length GC content
GACCUCCCACAACUGGAGCAGCCGGGAACAGCUCUGACCACAGUGGUUC… 6002 nt 0.4099
Summary

Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. [provided by RefSeq, Jul 2008]

Forensic Context

A review of forensic proteomics literature notes that the IPO5 is identified as a protein marker whose abundance decreases post-mortem in skeletal muscle tissue from human and animal models, specifically for early post-mortem interval estimation [Alex et al. DOI:10.1016/j.scijus.2025.101320].