| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGCGGCUGCCCGGCUGCCGAGCGCGGAGGCUCCGUCACGUGUUUUUCUC… | 9771 nt | 0.5077 |
This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
A study in humans demonstrated that the IRS1 was mentioned in the introduction as having lower expression in males with obesity [Haltia et al. DOI:10.1002/oby.70078], while another human study investigating burn injury noted the IRS1 was mentioned in the introduction and discussion but was not experimentally studied in that paper [Knuth et al. DOI:10.1097/SLA.0000000000005880].