| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUACUCACUGUGCGGCGGGGACCGCGACGAGCCCGGGUCGCCGUUGGC… | 8156 nt | 0.5866 |
This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. [provided by RefSeq, Jul 2008] CIViC Summary for IRS2 Gene
A study in humans demonstrated that a 7-day overfeeding intervention induced significant changes in the transcriptome of abdominal subcutaneous adipose tissue, with insulin receptor substrate 2 (IRS2) expression decreasing significantly in both lean and obese male subjects, though the change was more substantial in lean individuals [Shea et al. DOI:10.3945/ajcn.2008.25970]. A pilot study in human forensic autopsy cases demonstrated that RNA sequencing captured distinct molecular signatures associated with specific causes of death [Nakao et al. DOI:10.1016/j.legalmed.2025.102772].