Basic Information

Symbol
IRS2
RNA class
mRNA
Alias
Insulin Receptor Substrate 2 IRS-2
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_003749.3
Sequence length
8156.0 nt
GC content
0.5866

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3375.50 kcal/mol
Thermodynamic ensemble
Free energy: 100000.00 kcal/mol
Frequency: inf
Diversity: 0.00
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((((((((((((((...(((..(((((...((((((((((((.((.((.((.((.......)).)).)).)).)))..)))))))))((((...((((((..(((((.((......))..))))).(((((.((((((.(((.(......).))).))))))))))).....))))))..)))))))))((((((..((.(((.(......).))))).)))))).((((.((((((.(.((((..((.(((((((((((.((((..(((((((((.((((((...)))))).)(((((((.(((...))))))).....(((((.((((.(((((((((...)))))))))))))))))))))))))))))............(((((((((((.(((..(.((((..(((((((.((..((((((..(((((((.((......)))))))))))))))))))))))).))))..)..))).))))).))))))..((((((.(((((.......(((((....((((.(((((........))))))))))))))(((((.(((((((((((.....................................(((((((((((((((((((.((((....)))).....)))))....))))))....)))).)))).(((..(((((((((((((.((.((((((((((((((((((((((((((.((..(((((((.((((..((...))..))))........)))))))....(((((((((((((......))))..))).........))))))............))))))))))(((......((((((....(((.(((........))).)))))))))(((.((((((((((....((.((((((((((((((((.((.......((((.(((.....))).)))).(((((.((.(((((((((((.((.((((((.(((((((.((((((((((.(((((.(((((((.(((((((((.(((..((((((.((...)).))))))))))))).)).)))..((((...(((((((........)))))))..))))))))))).)))))((((...(((((((.((((((.((((((((......((((.....))))......)))).))))......(((((((..(((((.......((((......)))))))))..)))).))).(((((...............))))))))).)).))...)))))...))))..((((((((..(((.((((.((.(((((((((..((((((.((..(((((..(((.(...(((((((((((......((((.((.....)).))))(((..(....((((....(((((((...)))))))....))))....)..)))...((((((((.(((((....))..........))).)))))))).)))))))))))......).)))..)))))..))))))....(((((.((((((((.....))))))))...)))))((((.(.((((((.(((((....(((((.((((...))))))))).))))).))).))).).))))(((((((((((((..((((((((.(((((((((.(((((.(((((((((((((....((((((((.(((((..(((((((((.(((.....((((((((.......)))))))))))))))((((((((((..((.(((.(((.(((((...)))))((((((.((((.....)))))))))).(((((((((((((((...((((((((((.((((((.((.((((.((((....(((((...(((((((...((((..((((........((((.....))))........))))..))))...)))))))...)))))...)))).).))).(((...(((..(((.(((((((((((((....((((.(((...........))).)))).((.((..((((.(((...(((((.......))))).))).)))))))).........)))))))......)))))).)))..)))....)))..)).)))))))))))))))).)))))))........)))))))).))))))..))..))))))))))...)))))))))).)))))))).((((((((.((.......))..))))))))...(((......))).....))).))))..)))))).))))))))))))..(((((...((((...((((((.(.......((((.((.(((((....((((((((((.((((((.......)))))).)))))(((.(((((((.....(((((....))))).......)))))))..)))......)))))..))))).))))))..))))))).......(((((((.(((...(((.....)))....((((..((((.(((..(((.(((((((((..(..((..(....)..))..)..)))).))))).)))))).)))).))))))).)))))))..........))))...))))).)).))))))))..))))))))))))).))..))))))))).))))))))).)))))))))))))))))).(((...)))))))).))))))))((((....)))).(((((((.(((..(.(((((...(.((.((((((((((.((.((((((((((((((((((.((((....(((.(((.((((........))))))))))..((((((.((......))))))))))))(((((((...)).(((((.....)))))..((((((((((......(((.(((((.(((((.(..(((((((((((.....(((((......)))))...))))))...(((...)))((((((((....)))).))))..(((.((......)))))..))))).))))))))))).)))...))))))))))))))))))))))...((((..(((..(((...))).))))))).)))))....((((.(((.....((((((((.............(((((...(((.((((((.......)))))).)))))))).(((.(((.(((((((...((((......)))).)))).))).))).)))))))))))...))).)))).)))))).)).)))))))))))).).))))).)..).))...)))))))..........)).)))))))).))))).))))).......((((((.(((((.........))))).)))))))).)))))))).)))))))).))...((.(((((((.((((.(((((((((.((...)).)))).))))).)))).((.(((.(((((...)))))..))).))...........(((((..........)))))......)))))))))..)).))))))))...)))))).....(((.((((((.........))))))))))))))))..)))))))))))..)))).)))))))))))...))))))))))))))...))))).....))))))))))).(((((.((..........)))))))))))))))))))))).)).....))))))))))).))))((((((((((((((((...))))))))))))))))(((((((((((....))))))))))).)))..)))))))))).......((((((((((....((......((((.((.((((((.(((((....))))).......(((((.((((((.(((..((((.(((.....))).))))))))).))))))))).((((.(((.......))).)).))...)))))).)).))))....)).))))))))))((((((.........((((...)))).........(((((.(((....)))...))))).....(((((((((((((((.((((...(((((((..((((....(((.(((....)))...)))(((((((.(((((.(((((((.....((((((((((......))))).)))))...)))).......))).))))))))))..)).)))).)))))))..)))).(((((((....)))))))))))))..))))))...))).))))))((.(((((((((((.((((((((((((..((((((.....(((((......((.(((....))).))(((((((..((...(((((......)))))((.((....)).)).))..)))))))..(((((((.(....))))))))))))).....)))))).)))))))))).)).)))).)))))))))(((((((..(((((.(((.((((((.(((((...))))).))))))))))))))((((...(((((((((((((.....(((((((((....(((.((((........((((.(((((..(((....))).))))).))))..((.((((.(((.(.(.(((((.(((((((((((((((((..((((..(((((.....))))))))).)).)))))))))))..((((((((.......)))))))).......))))))))).).).))).))))))....(((((.((...))))))).....)))).)))..)).)))))))....)))..))))))...))))..))))..(((((((....)))))))(((((.....))))).......((((((.....))))))(((((((............)))))))..........(((((((((((((.(((((((((..((.((........)).)).))))))))).((((....))))...((((.(((.(((....(((((((...((((((((...........(((...((((.((((((((...((((.((.(((.((((((((((((((((..((((((....))))).)..)))))))).((((((((..(((((((((((((.(((((((((....((((((((((((....)))))...))))..)))(((.((((((((((((((((((((((....((((.(((((......(((..((((....))))..))).....))))).))))...(((....(((.((((...(((((....)))))..)))))))...)))(((((((((.(...((((.....))))....).))))))))).(((((((((((((..(((((...(((......)))...)))))..))))...))....)))))))))))))))))))...)))))))))))))..((((........(((((((((.....(((..((((((((..........((((....(((((((((......................)))))))))....))))((((((((((((((((.((((....((((.(((........(((((....)))))))).))))...))))))))..)).)))))))))).........................(((((.((((.((((((((((((((......(((((((((((((((.((((((((.(((...((((((...............((((((((.....))).)).))).........(((((((......)))))))..(((((((((....)))))))))(((.....))).(((((..((((.............)))).)))))....(((((((....)))))))))))))..))).))))....))))))).))))(((.(((((((((.....(((((....)))))(((.(((((......))))).))))))))))))))).........)))).))))...)))))))))))..))).)))).)))))......((((((....))))))...))))))))...)))))))))))))))).......)))))))))..(((((.(((.((.((....((((((((((((................((((((((...((((((.((.(((.((.....))....)))))))))))))))))))))))))...))))))......)).)))))))))).........(((((((((.(((((...(((((((((.((((...((((..........))))..))))((((.....))))((((((...)))))).......)))))))))..(((..((((((..(((((.(((.(((((((.((((((..((((.((...((((...))))...))))))((((((((((((((((((((((((((.(.(((.....(((((..((((((...........)).(((((....)))))..))))..)))))...)))).)))))))))))........((((.....)))).......(((((............((((((((.......((((((((((((.......(((((((......................((.(((((..((((..((((((((((((((((...((((....))))...)))..............)))))))))))))....((.(((((.(((...((((((((.((((.((................)).)))).))))))))...)))))))).)).........(((((.(((((((.....((..(((((((.(((......))).)))))))..))...)))))))...)))))))))))))).))(((((.....(((((...((((((.....((.((((..(((((...((.((((...)))).))...))))).)))).))...))))))...))))).....))))))))))))....((((((......)))))).)))))))..)))))....))))))))..))))).(((((..(((((((.............((((....)))).(((((((((.((((......))))..))))))))).......((.....))......................((((.((...........)).))))((((((.(((((((.....)))))))))))))......)))))))..))))).((((...))))......)))))))))..)))))).))))))))))).....)).))))))))..))))))..))).((((.(((((((((((.....)))).)))))))(((((........))))).)))).(..((((......))))..).((((.(((((....))))))))))).))).))))))))))))))))).....(((.(((.((..((((...(((....)))..))))))))).)))...(((.((((((((((.................)))))))))).))).)))))...........))))))))..((((((........))))))..((.(((((((((.((((..(((.((((.....)))))))..((((((....)))))))))))))).)))))..))......(((((((.(((...)))...)))))))..))))))))....))).)).)))).................((((((((......))))))))...((((........)))))))))))).))))...)))((((....)))).((((.....))))))))))))....)))))))))))))))))((....)).....(((((......)).)))..............))))))))))))))))))))...............(((((((.((((((((((((....))))..................(((....)))...(((.((...((((((...((((..((........))..)))).)))))).)).)))(((((........)))))(((.(((..(((((....(.(((.......))))...)))))....))).))).....).))))))).)))))))............)))))..........

Transcripts

ID Sequence Length GC content
GUUACUCACUGUGCGGCGGGGACCGCGACGAGCCCGGGUCGCCGUUGGC… 8156 nt 0.5866
Summary

This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. [provided by RefSeq, Jul 2008] CIViC Summary for IRS2 Gene

Forensic Context

A study in humans demonstrated that a 7-day overfeeding intervention induced significant changes in the transcriptome of abdominal subcutaneous adipose tissue, with insulin receptor substrate 2 (IRS2) expression decreasing significantly in both lean and obese male subjects, though the change was more substantial in lean individuals [Shea et al. DOI:10.3945/ajcn.2008.25970]. A pilot study in human forensic autopsy cases demonstrated that RNA sequencing captured distinct molecular signatures associated with specific causes of death [Nakao et al. DOI:10.1016/j.legalmed.2025.102772].