Basic Information

Symbol
ISG15
RNA class
mRNA
Alias
ISG15 Ubiquitin Like Modifier UCRP IFI15 G1P2 Interferon, Alpha-Inducible Protein (Clone IFI-15K) Ubiquitin Cross-Reactive Protein Ubiquitin-Like Protein ISG15 HUCRP IP17 Interferon-Induced 17-KDa/15-KDa Protein Interferon-Stimulated Protein, 15 KDa Interferon-Induced 15 KDa Protein Interferon-Induced 17 KDa Protein IMD38
Location (GRCh38)
Forensic tag(s)
Chronological age estimation Cause of death analysis

MANE select

Transcript ID
NM_005101.4
Sequence length
637.0 nt
GC content
0.6421

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-287.20 kcal/mol
Thermodynamic ensemble
Free energy: -299.39 kcal/mol
Frequency: 0.0000
Diversity: 157.21
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((.(((((..(........(((((((.((.((((..((.(((((((..(((.(((((((..((.....))..))))))).(((((((((.((.((.((((.(.(((((.(........).))))).).)))).)).)))))))).)))...((...((((((((((((.((((((.((((.(.(((((((((((((((..((.((.((((((((((.....)))).)))(((((....((((((((.((..((((((.((((((((.((....))..)).)))))))))))))).))))...(((.............)))((((....)))).......(((((((....))((((...))))(((((((...))).))))))))).))))..))))).))).)))).))))))))))))))).).)))..).)))))).))..((((.(((((...))))).)))).(((((....)))))..((((((((.((((......))))..))))))))....)))))))))))).)))..)))))))))..)))))).)))))))....).)))))...))))((((.....))))(((.((((.........)))).)))..........
Thermodynamic Ensemble Prediction
.{,,({((.(((((..,...,{...(((((((.({.((((..({{(((((((..(((.((((((,{{(({{,..,,..))))))).(((((((({,((.((.((((.(.(((((.(........).))))).).)))).)).)))))))).))).,.}|}|.((((((((((((.((((((.{(((.(.(((((((((((((((..((.((.(((((((((((.{{{||.|{}|}(((((....{{((((((,(({,({{,{,|||||{,,|,||}}..)),}),}})})))))),),))}))))...(((..{{..,,|,,,.}}}{(((....)))}.......{(((({(.||,{|((((...}))),{{||||...},,.}}))))))).}}}}..}}})).))).)))).))))))))))))))).).)))..).)))))).||.,((((.(((((...))))).)))).,||(({{{{,,,,,}}||||{{((,{{{{.,,,..||||,.}}})))))..}.}))))))))).,,)))..)))))))))..))))}).)))))))....,.)))))},}),))((((.....))))(((.((((.........)))).)))..........

Transcripts

ID Sequence Length GC content
GGCGGCUGAGAGGCAGCGAACUCAUCUUUGCCAGUACAGGAGCUUGUGC… 637 nt 0.6421
Summary

The protein encoded by this gene is a ubiquitin-like protein that is conjugated to intracellular target proteins upon activation by interferon-alpha and interferon-beta. Several functions have been ascribed to the encoded protein, including chemotactic activity towards neutrophils, direction of ligated target proteins to intermediate filaments, cell-to-cell signaling, and antiviral activity during viral infections. While conjugates of this protein have been found to be noncovalently attached to intermediate filaments, this protein is sometimes secreted. [provided by RefSeq, Dec 2012]

Forensic Context

A study in humans demonstrated that the ISG15 is a differentially expressed mRNA elevated in middle-aged individuals and linked to type I interferon signaling, serving as a predictive feature in an age estimation model for peripheral blood [Liao et al. DOI:10.1016/J.Fsigen.2025.103373]. Research in a mouse sepsis model and human validation identified the ISG15 as a gene/protein marker indicating the acute infection stage, with higher expression in lethal groups, and its diagnostic potential was confirmed in human cohorts [Zhang et al. DOI:10.1093/jimmun/vkaf140].