| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGCGGCUGAGAGGCAGCGAACUCAUCUUUGCCAGUACAGGAGCUUGUGC… | 637 nt | 0.6421 |
The protein encoded by this gene is a ubiquitin-like protein that is conjugated to intracellular target proteins upon activation by interferon-alpha and interferon-beta. Several functions have been ascribed to the encoded protein, including chemotactic activity towards neutrophils, direction of ligated target proteins to intermediate filaments, cell-to-cell signaling, and antiviral activity during viral infections. While conjugates of this protein have been found to be noncovalently attached to intermediate filaments, this protein is sometimes secreted. [provided by RefSeq, Dec 2012]
A study in humans demonstrated that the ISG15 is a differentially expressed mRNA elevated in middle-aged individuals and linked to type I interferon signaling, serving as a predictive feature in an age estimation model for peripheral blood [Liao et al. DOI:10.1016/J.Fsigen.2025.103373]. Research in a mouse sepsis model and human validation identified the ISG15 as a gene/protein marker indicating the acute infection stage, with higher expression in lethal groups, and its diagnostic potential was confirmed in human cohorts [Zhang et al. DOI:10.1093/jimmun/vkaf140].