Basic Information

Symbol
ITGA2
RNA class
mRNA
Alias
Integrin Subunit Alpha 2 GPIa VLAA2 HPA-5 CD49B Integrin, Alpha 2 (CD49B, Alpha 2 Subunit Of VLA-2 Receptor) Very Late Activation Receptor Subunit Alpha-2 Alpha 2 Subunit Of VLA-2 Receptor CD49 Antigen-Like Family Member B Platelet Membrane Glycoprotein Ia Human Platelet Alloantigen 5 Collagen Receptor Alpha 2 Integrin Integrin Alpha-2 Glycoprotein Ia Very Late Activation Protein 2 Receptor, Alpha-2 Subunit Very Late Activation Receptor Alpha-2 Subunit Human Platelet Alloantigen System 5 Platelet Glycoprotein GPIa Platelet Antigen Br VLA-2 Subunit Alpha CD49b Antigen FMAIT3 VLA-2 BR
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_002203.4
Sequence length
7843.0 nt
GC content
0.4014

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2182.30 kcal/mol
Thermodynamic ensemble
Free energy: -2331.86 kcal/mol
Frequency: 0.0000
Diversity: 1887.37
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((((((((.....))))))((((((((((((((((((((.((((((.(((....))).((((......))))(((((((((((.....((((((((((......)).))..))))))....(((.(((.(((...))).)))))).))).))))).))).....((((((...(((........)))(((((((((.(((.((((((((((.((((((((..((.((((((((((..((((.((((.((.(((((..(((((((...((((((((....((((...((((..(((.....(((((((((...(.((((.....)))).).))))).(((((((.((........)).)))))))))))...))).))))...)).)).....)))).))))..))).......)))).)))))))))))))))(((........)))((((....)))).........((((((((.(((((...((((((((((((..(((((((((((((((((((.....((((.............))))..(((.((((.((((((((...(((((........((((.(((((((((((.(((.((((.((((((..((((....(((((((..((((((((((((((.((((.(((((..((((.(((....((((((((((((......((((((((..............(((((((((...((((((((..........)))))))).))))))...)))..............((((((((...)))))))).......))))))))......))))......))))))))....((((......))))...........(((.((((..((.....((((.(((........))).))))((.(((...))).)).))..)))))))((((.(......).))))........((((.(((((((.....))))))).))))))).))))))))).))))))))))))))))))...)).)))))...))))....(((((..((((..............))))..)).))).......................(((....))).....((((.(.(((((...(((((((......(((((((...((((.((........))))))...))))))).(((((.(((((((....)))))))..)))))..)))))))....))))).).))))(((((((....(((((...((((.....))))..)))))...))))))).....))))))))))))))))))...)))))))))))))))...))).))))).)))))))(((((((((((((.................(((((((((((((.(((...((((((..((((.((((...((....)).))))))))..)))))).))).))))((((((...((((..((((((((((...)))).......)))))))))).)))))).....(((((((((((((((((.........)))))))....((((....))))(((((...((.(((.(((((((((((.((..((((((.......))))))....((((((((((...(((((((....))).))))...)))).))).))).(((........))).(((.((...)).))))).))))))))))))))))..)))))(((((((..(((((((.....((((...))))(((((......))))).((((((((((((((((........((.((((......)))).)).......))))))))))))...))))((((((........))))))...((((......))))(((((((((((((.(((.(((...((((((((((((((......))))))...(((((..((....))..)))))....)))))))))))))))))).))))))))))))))))...((((.....))))((((((((....)))))))).((((((((.((.(......).)).))).)))))...)))))))..((((.....)))))))))))))).............)))))))))......((((.((.((..(((..((((.(((......))).)))).)))..)))).)))).....))))))))))))).........(((((....)))))....(((((....)))))((((((((((...)))))))))).................)))))))))))((((((.(((.(((((((...((.(((((((......((((((((...................))))).)))))))))).)))))))))....((((....))))((.....)).((((.......))))......)))))))))((((((.....))))))......(((((.(((((.....))))).)))))(..((((((((((.........(((((((((((((((((.......((((..(((.............))).))))((((.........))))....((((((((...)))))))).......(((((((.((.((((((.......))))))))))))))).....((((((((...((((....(((((((..((((((.(((((((.(((..(((((.(((((......((((.(((((..((.((((((...)))))).))...)))))...))))....((((((((((((((........((((((..((...........(((........))).(((((((((((((..((((((..((................))))))))(((..((((((((.(.(((.........((((((..(((.(((....((((((((((((.........(((((....)))))...((((((...(((.(((((((..((((((((.((.(((....(((((((.............)))))))...))).(((((((((((((((((((((((((..((((.(((((((...(((.(((...((.(((((...................)))))(((((((.....))))))).........)).))))))...))))))).))))((((.....(((..........))).....))))...((((....(((((....)))))....)))).....(((....))).))))..)))).))))))))).....)))))))))))))))))).))))))).)))...))))))....)))))))).))))....))).)))....)))))).(((((.(((((((....((..((((((.(((((......)))))......(((((((.((((.(.....).)))).))).)))).......))))))..))......)))))))..))))).((..((((.(((((((..(.(((((.((((((((((.((((((((....))))....)))).)))....))))))).))..........))).)..))))))).))))..))......)))...).)))))))).))).....)))))))).)))))......((.(((((((((..((.((((......))))(((((((((.(((((((.(((.....)))..))))))).((((((((((((((......)))).))))..........))))))(((...((((((.(((((...((((.....))))...))))).))))))..)))........(((((((((((((((((((.(((((((((..(((((...((((((.......)))))).........(((((((..((((....))))...((((.....))))((((..(((.((.....(((((((((.....))))..))))).....)).)))..))))((((((((.((((((.............(((((((((((......))))))))))))))))).))))))))(((((..((((.(((((((((((((((.....))))))))))))))).))))(((((....)))))................((((((((.........))))))))......)))))..........(((((((.(((...(((((..((((((.....))))))....(((((((.......(((((.((((.......)))))))))(((((((((............((((((((............((((........))))))))))))....(((((..(.........)..)))))))))))))).....(((....(((((........)))))....)))........................(((((((.((((.....((((((((((((((((((.........)))))))))))).......))))))((((.(((......))).))))..))))..)))))))..)))))))...............)))))...))).))))))).))))))))))))..))...........(((((....)))))................))))))).))...(((((((....((...))...)))))))...))))))))))))))))).....)))))))))......)).))))))))).))....))..))))))..)))))))))))))).........)))))))))).))).))))........))))))))).))))))).............)))).)))))))).(((((.....((....))...)))))...)))))).))))).))))))......))))))))))..).(((((((((((((.(((...(((((((((.(..(((((...................)))))..).))))))))).((((((....(((((......))))).))))))..(((((((.(....))))))))........)))))))))))))))).........(.(((((......)))))).((((((((((((....((......))...))))))))))))))))))))...))))))).......................)))))...))))))))))))).((((.....(((((((((.....)))))))))...))))...(((.((.(((((((((((((((((((...((((((((.......((((((((((((((((((....))))))..))))...)))))))).((((....))))...........(((((((.....))))))).......................((((((.......)))))).......))).)))))....((((....((.(((((....))))).))))))((.((((((.(((...))).).))))))))))))))))).((((((.....)))))).....(((((.(((...))))))))............(((((...))))).((.((((.......)))).)).(((......))).)))))))))..)).)))..............)))).))))))))..))))))....................................((((((.....))))))(((((((.(.((((.....)))).))))))))((((((((.((.........)).))))).))))).))))))((((((((......((((((((......)))))))).........((......)).....)))))))).....................)))).)))))))))))).((((.....)))).....((((((....)))))))))))))))))).)))).)))))(((((((((((((((...(((((((......((((......)))).................((((((((....((.((((....)))).)))))))))).(((((.(((((((((((((((((((((((..((((((.(((((.((...(((((.((((....)).)))))))....)).(((((((((((((((.....)))))))...................(((((((((((.............)))))))))))..((((((((((........))))))))))..........((((((((((((((.....)))))(((((((........)))))))..............(((((.((.((((((((((((.(((......))))))))))...))))).))..)))))((((((..(((.(.....(((........)))).)))..)))))).................)))))))))......))))))))....))))).))))))..)))))))))).))))..((((((((((..((((((((.((((((((.....)))))))).))))))))....)))))..)))))))))).)))).))))).))))).))((((((((((((((....(((((........(((((....))))))))))..))).....)))))).))))).))))))))((((((..(((.((((((.((((..((((((((..(((((.(((((((...(((((((.....(((((.((((((...............((((((((.......))))))))(((((.....)))))............((((((...))))))....(((.((((..(((((...)))))......)))).))).)))))).)))))........(((((.((......)).)))))............(((.(((....((((((.(((......)))))).)))....))).))).....)))))))...))))))).)))))........)))))))).)))).))))))........))).))))))...............(((.(((((((((....))))))))).)))((((((((((((((.......)))))))))).)))).....)))))))...................(((((..((.((.........)).))..))))).(((.((((((..(((.......).))..))))..)).)))..........)))))))))))..(((((((((((....((....))....))))).(((((((((.(((.(((...(((((......)))))...))).))).)))))....))))(((.......(((((((..((.....))..))))))).......)))(((((((....((((......((((((..(((((....((((((((.....(((((((((.......))))))))).....)))))))).((((....))))((((((.......))))))..((((.((((...)))).)))))))))))))))))))...))))))).(((((((((((((((((.(((.((((((((((((.(((((((..((((......((((((((........)))).))))......))))..))))))).)))))))).(((((((((....(((((((((((.....))))))..))))))))))))))..)))).))).)))))((((((((................))))))))...)))))))..)))))............))))))((((((......))))))...))))))))........
Thermodynamic Ensemble Prediction
..((((((((((((((.....))))))(((((((((({{({((((((,((((((.{(({,..,}}.{{{,......}||,(((((((((({.....((((((((((......)}.))..))))))....(((.(((.(((...))).)))))).))).))))).))).}},.((((((..{(((........}}}|((((((((.(((.((((((((((.(({.,,,.......{(((((((((,{{.{{(({{,,{(((((,,((((((({({(({{{{{,.....,{,...,{|((((|{,,,.||||}}||||({{{{(((,(({(((((((({..(((((...((((((((((((.,,,,....(((((((((.......(((((((((((,,,,,,......,.....{{{,...{{{{((,,.,}|||}.,||}|.,(({{{{{..,..((((....)))),.{,,||.{||}..,,,)})}}..,)},))))))}))))))))))),.(((((((((((..,,.((((.............)))}..(((.((((.((((((((...(((((........((((.((((((((((((((,{(((,,((((((..((((....(((((((..((((((((((((((.((((.(((({.,((((.{{{....{(((((((((((......((((((((......,,......(((((((((...((((((((..........)))))))).))))))...)))...........,..((((((((...))))))))..}....))))))))......)))),.....}))))))}...{((({......})))},..,,.....{{(.(({(,{((...,.{(((.(((........))).)))},{.{{|,,,)})})),}}..|}}},}|{(({.|..,,..}.}}})},,,...,{(((.(((((((.....))))))).)))))}}.))))))))).))))))))))))))))))...)}.)))))...))))....{({((..((((..{{......,,..))))..)).})).................,,{,..(((....)))..},|((((.(.(((((...(((((((......{((((((...((((.((........))))))...))))))}.(((((.(((((((....)))))))..)))))..)))))))....))))).}.)))}{((((((....(((((...((((.....))))..)))))...))))))).....)))))))))))))))))),..}))))))))))))))...)))}})))).)))))))(((((((((((((...............,,(((((((({((((.(((...((((((..((({{((((...((....)).))))))))..)))))).))).))))((((((...((((..((((((((((...)))),......}))))))))).)))))).....((((((((((,.,{(((.,({(,.,((({{{{{.{{{...|,,..(((((((((,{(((,(((.{(((((((((({(((.{(((((.......}))))}.}}.))}|}}|||,...{({(((((,,({(((,({|{,.,,,,..)).)))}}}}}...{{{.||{.(((.....})).))).)})}))))))))))))))...||{({{{..,,,,,,....,}}..}|||(((((((((((((..{((({({...((((((((((((((((..,,,,..((.((((......)))).))..,,.}.))))))))))))...)))}((((((........))))))...((((......)))){((((((((((((.(((.(((...((((((((((((((......))))))...(((((..((....))..)))))....))))))))))))))))))}})))))))){{{{,{{{...,,,}}}})))},..,))).)))}.,.))))))))))))|,{.,,.}}}}))).)))))))))...},..,)})}},})|))}}}....)))))))))))))..,..........))))))))}..,}..((((.((.((..(((..((((.(((......))).)))).)))..)))).)))).....))))))))))))).........(((({....)))))....(((({....))))}((((((((((...))))))))))...........,,....))))))))))).}....((((((((((((...((.(((((((......((((((((.........,{{...,,,.)))))}}))))))))).))))))))).({((((((((.{.{{((,....|,.(((,...|,..,||,...,.,|,,....{{({{{{{,..,.)))}}})))...(((((.(((((.....))))).))))).(((((..,{{....})....)))))..)))))))}})}..))))}((((..(((,,,......,},.))).))))..,,........))))))))}((((((((...)))))))).......(((((((.((.((((((.......))))))})))))))).,.......,}}},.)))),}},})))))...)))))..}))))..,}}||..|||,}}|||||}|||}|{({{,({{{{..||,|||||{,,,)))))),}}.,,))}}}...}}}},...{(((((((((((({..,.,,,.,{((({......,,.||},,.{{({{,...,,|{{.((((((((((({{..{(({{{..,{.........,..,...,}})))))|{{..{{{{{||{.|,|,,....,..,,{{((({.,{{,.(((....((((((((((({.........(((((....)))))...((((((...(((.(((((({{.((((((((.((.(((....(((((((.............)))))))...))).(((((((((((((((((((((((((..((((.(((((((...(((.(({...,{.(((((...................)))))(((((((.....))))))).........}).))))))...))))))).)))).{{{.....||{.,{{,,.,,,|||.....,,,},.,||||,...{((({....))))}..},))}|.....|,.....,}}.))))..)))).))))))))).....)))))))))))))))))).))))))).)))...})))))....)))))))).))))....))).,}},,{,|||}}}.,{{{{.{{{{{{{.,|,||,,|{{{{{.(((((......)))))......{((((((.((((.{.....}.}))}.))).)))).......})))))..}}..,,,,||||}}|,,||}},.((..{{{{.{((({(({({.,{{{(,({(((((((,.{{{{{{||,,,,)})),...}})),),)}}..}||||||,|||,,,,,,,,.|||,.,,}}})))}|||}}..}}......}}}...),})}))}},.,}}....,)))))))}.)}))),...},||.(((((((((..{,.((((......))))(((((((((.{((((((.(((.....)))..))))))}.{{((({{{((((((......))))))}}}.......,,.}}}}}|{,,...({((((.(((({,,.{(({....,)))}.,,))))).))))))..}}},.......(((((((((((((((((.{.(((({{(((..(((((...((((((.......)))))).........(((((((..{(((....)))}...{(((,,,,,,|||{(({..,,,.,,.....||,|||,||}},..,,,||..||||{....))})),.,},,,{(((((((.(((({{,,.....,,..,{(((((((((((......))))))))))))))))).)))))))}{((({..((((.(((((((((((((((.....))))))))))))))).)))){((((....}}}}),,{,,,....,,,,,.((((((((.........))))))))..,,,.)))))..........(((((((.(((...(((((..{{,{{(.,,,,||||||,...(((((((.......((((||((((.......))))))))){(((((((,............((((((((...,,,......{{{{,......}))))))))))))...{(((((..{.........}..)))))))))))))}.....(((....(((((........)))))....)))...,,,,....,|...........(((((((.((((.....{(((((((((((((((((.........)))))))))))).......)))))|((((.(((......))).)))),.))))..)))))))..))))))).....||},,,}}..)))))...))).))))))).))))))))))))..))}..,,......(((((....)))))...........,,,,.}}}}))).,....(((((((....({...))...)))))))...))))))))))))))))).....))))))))),,....)).))))))))).}),}},,.},))}))))}))))))))))))))...,,|,..,,,,,)}})).,}))))))}}}}},,}},,},.,})}})))|||{{{{{(({,{{{,,{|,,..,,,),},,},)))}}.}))))||||||,,|||....{{{||||{{{,,,||||,|{|.,,,,.,,{{{{{{,,,.(((((((((((((.(((...(((((((((.(..((((({,...............}.)))))..).))))))))).{(((((....(((((......))))).)))))}.{(((((((.(....})))))))},}}....))))))))))))))))...|((((.,.{((((......))))}|.((((((((((((....((......))...)))))))))))).))))},|.||||{{{,,...||||,||||||{,,,,{{,{.,||,,,||||{{,{{,.(((.((((.....(((((((((.....)))))))))...)))).)))..,...,...,{{{,,,,,|||||,...|{|{{|{{,{{{{..,{{((((({{({((((((....))))))..}}))||,|||||||||{{|,{{{{{{{(({(({{{{|||||{|{{{,...|)))))}},,.....................((((((.......)))))).......||||,|||,...{((({...,||.(((({....,)))).},,))}||,|{{((({((,{{.|||.,.,},))))),)))))),}.{(((((.,.,.||}|}}.....{((((.{({....,,,}}},.,..........(((((...}}|||,{{,|{{{.,,,,..}}}}.||.|||}||{(((({{{{.||.|||,,|{{{{..,||||||.,,,,}}}}).)))))),,))))},.)))}))}}}}...{{{{.|||................)))))))))}{{{{{{((((((({,(.((((.....)))).))))))))),.|||||}{,{{{,{{{..||.|||)|||,}}}.)})}}|((((((((......((((((((......)))))))).........((......)).....))))))))}....................}})).})})))))}}}|.((((.....)))).....((((({....}))))))))))})))))}.))}}.))}})((((((((((({(({...{{(({{|,...||((,{....,})))}.................||{(((((....||.{(||..,,)}}},|})))))))).(((((.(((((((((((((((((((((((..((((((.(((((,(({,,(((((,(({(....}}.|||}|||,|,.||.{{{{|||||.|||||,.,||||||||||..................{((((((((({,{,,,,.,,,,..}}))))))}}}..((((((((((........))))))))))...............(((((((((.....))))))).}}........{,|||{||||,...,,,,,,,,,{{{{{.{(.{(((({{((((,{(((......))))})}})),,.))))).))..)}}}}},{(,.(((((......)))))...}}.,})),,}||||||.|||...............,,)))))))}}}},,,.}))))))),}}.))))).))))))..))))))))))}})))..((((((((((..,(((((((.((((((((.....)))))))).))))))),....)))))..)))))))))).)))).))))).))))}.}}((((((((((((.({.{{(((((,.......{((((....))))))))))..)),}}..,)))))).))))).})))}})),,,,,,..|,..((((((.((((..(((((((((((((((.{((((((...(((((((.....(((((.((((((...,.,.........((((((((.......)))))))){((((.....))))|,,,,,,......((((({...})))))..,.,(({(,,,}}}|,|,,,,}))}|,.....}))},})).)))))).)))))........(({{{.{{,,....},.))))).......,,...(((.(((....((((((.(((......)))))},)))....})).))).....)))))))...))))))}.)))))....,,..)))))))).)))).)))))).......|}}},}},)))..............{(((.(((((((((....))))))))).))}|,{,((((((((((.......)))))))))).}}},.,,,,))))))),|,,.....,.......,,||(((...,.||.....,,,})).}},,),}||.(((.((((((..({{,,.....),))..))))..)).))}..........}})))))))))..,,{{,,(({((.,..{(,...||.,,,)}}}}.{|{{{{{{{.{{{.,||}},(((((......))))).,,)))}))),))))},}.}})))|}|,,,|||.|{|||{(|||,...,,|,,.|||||||{{{{,....,|||||,(((((((.,......,,,,,...},.))))))|{((((({.....(((((((((.......))))))))).,,{{|||||||,,,{,{,,{.,,))}},.,.}))}}}}}}))||||((||.{{|{..|}}},.}})))}}}}}}},,,,,}},,,}}}}}}}.||||||{{{{{((((((.(((.((((((((((((.(((((((..((((......((((((((........)))).))))......))))..))))))).)))))))).(((((((({..,,{((((((((((.....)))))),,)}})))))))))))..)))).))).))))){(((((((,,{{....}}.||,..}}}))))},,.})))))},.,))))....,,,,,,}}}}}}}}((((((......))))))...))))))))........

Transcripts

ID Sequence Length GC content
AGAGAAGCCCUCUGGACAGCUUCUAGAGUGUGCAGGUUCUCGUAUCCCU… 7843 nt 0.4014
Summary

This gene encodes the alpha subunit of a transmembrane receptor for collagens and related proteins. The encoded protein forms a heterodimer with a beta subunit and mediates the adhesion of platelets and other cell types to the extracellular matrix. Loss of the encoded protein is associated with bleeding disorder platelet-type 9. Antibodies against this protein are found in several immune disorders, including neonatal alloimmune thrombocytopenia. This gene is located adjacent to a related alpha subunit gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]

Forensic Context

A study in humans characterized the platelet transcriptome in patients with acute myocardial infarction (MI) and identified the ITGA2 as positively correlated with platelet aggregation to collagen [Eicher et al. DOI:10.3109/09537104.2015.1083543].