Basic Information

Symbol
ITGA2B
RNA class
mRNA
Alias
Integrin Subunit Alpha 2b GPIIb Integrin Alpha-IIb PPP1R93 CD41B CD41 GP2B Integrin, Alpha 2b (Platelet Glycoprotein IIb Of IIb/IIIa Complex, Antigen CD41) Platelet Glycoprotein IIb Of IIb/IIIa Complex Protein Phosphatase 1, Regulatory Subunit 93 Platelet Membrane Glycoprotein IIb GPalpha IIb Integrin, Alpha 2b (Platelet Glycoprotein IIb Of IIb/IIIa Complex, Antigen CD41B) Platelet Fibrinogen Receptor, Alpha Subunit Platelet-Specific Antigen BAK AlphaIIb Protein CD41 Antigen BDPLT16 BDPLT2 FMAIT2 ITGAB HPA3 GT1 GTA GT
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_000419.5
Sequence length
3479.0 nt
GC content
0.6079

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1510.00 kcal/mol
Thermodynamic ensemble
Free energy: -1564.22 kcal/mol
Frequency: 0.0000
Diversity: 909.39
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.((((((((....((......((((..((((((....)))))).)))).))..))))).))).))))...(((((((((.(((((.........(((.(((((....))))))))..(((..((((((.((.(.(((((((...(((..((((((((((((((.(((((.....((((((((.(((((.......)))))..))))))))((((((((((((((((((((((((...(((((.(((((((((.((((..((((((((...((((((((((((((.((.((.......((((((((.(((((((....(((((((....((((.(((......((((((((((...(((..(.(((((..(((((.((...)))))))(.((((.(((((...(((((.((..(((((.(.....).))))).))))))).))))).)))))))))).)..)))..)))).))))))...))))))).(((.((.........))))))))))))...............((((.(((.....)))))))((((.((........)).))))))))))).)))))))).....)))).))))))..((((((.((..........((((((((.......((((((((((((((((((((((((...))))))))))(((((((((.((((((((..(((((.((((((..((........((((......))))............(((......)))))..)))))))).)))...((((((..(((((.....)))))..)))))))))))))).))....)))))))......(((.(((.....(((((((((((((((..((((..((((....))))..)))).((.(((((....(((((.(((((.((((....(((((((((((((((.((((.(((((((.........((((((((((((....))))))))))))(((((...(((((((.(.(((.........)))...).)))))))))))).(((((((..((((.(((((((.(((.(((....(((((..........)))))((((....((((((((.(((..((((((((((((.((((((((.((.((((((.....))))))((((......))))(((.......))).(((.(.(((.(((((.......))))).))).).))).........)).)))))))).)))))...))))))))))))))))))...)))).))))))((((.(((((..((((.....))))...))))).)))).....(((((((..(((...)))))))).))(((((.((....)).)))))..((((((............))))))((((((...))))))))))).))))))..))))))))))).))).))))))))))).)))))))))))).))))).))..((((...((((((((..(((((.((((.((((..((.((((....(((((..(((((((((((.(.((....)).).)))).)))).........))).)))))..((((.(((((......))))).))))))))))..)))).)))).)))))...))))))))...)))).(((.(((((...))))).)))..((((((((((((((..............))))).....)))).))))))))....))))).))))))))))..))))).)).....))).)))))))))).............((((((((((((((((((.(((((((((......)))))).))).)))))))........((.((((.((((((((((.....((((..((((..........)))).))))((((........)))).(((((((....(((.((((((((((((((((.(((((((........))))))).......))))))..(((((((.(((((((.....)))).((((..((.(((.((((((......))))))))).))))))..........))))))...)))))))))....(((((((((((((......(((.((((.((((((.((..(((((((((((.(((.(((((((((.....)))))....(((((........))))))))).)))))).))))))))......))..)))))).))).).))).....)))))).....)))))))((((((..((...))..)))))).((((...)))))))))..)))...)))))))........)))))))))))))).))..((((((..................))))))...(((.((.(.(((((....))))).).)).)))((((.(((((....))))).).))).))))))))))).))))).)).....)))))....)))...(((((......)))))))))))))...))))))))..))))))))...(((((((.(((((....))))).))).)))))))).)).))))))).)...))))....))))))))..(((((.....)))))(((.((....(((((((.((....)).)))))))......))))).((((((......)))))).....))))))))))..))))))...(.(((((((((((..(((.((((.(((((((......)))..(((((((((((..(((.(((.((((.(((((((.(((.(((.......))).))).)))))))((.(((((((((((((.((...........(((((.((.......(((((.......)))))((((.((((.(((((((((((....((((((((.((.(((((((......))))).))...(((((.((((((....)))))).))).)).((((((((((((.(((.....))).)))))(((((......))))))))))))((((....))))....)).))))))))(((((((...((((.(((....))))))))))))))..((((((.(((((((((..((((.((.........))))))....))))))......)).).)))))).)))))).))))).)))))))))))))))..........)).))).))))).))))).)))))).))))))((((((((.(((.(((((((....))))...))).))).))).......)))))....)))).)))))))........)))).)))).)))((((..(((...)))..)))).........))))))))))))((((.....))))....)))))))).))))...((.(((((.(....).))))))).....(((((((....))))))).......))))))).)))...))))))).).))))))))....))).......))))))))))))))
Thermodynamic Ensemble Prediction
((((.((((((((....{{......((({..((((((....)))))).))))})}..))))).))).))))...,(((((((,{(((((.........(((.(((((....))))))))..(((..((((((.((.(.(((((((.,.(((..((((((({((((({{(((((.,{,.((((((((.((((({.....,)))))..))))))))|||(((((((((((((((((((((...(((((.(((((((((.((((((((((((,,...,{{(((((((((((.((.{{.......((((((((.(((((((.,{{{{(((((.,{,((((,(((..,...((((((((((...(((..(.(((((..(((((.((...)))))))|.((((.(((((...(((((.((..(((((.{.....}.))))).))))))).))))).)))),))))).)..)))..)))).))))))...))))})}.||||.|||},.,...}|||||||..||.......,,,...,}|{((.({{.,...)))))))((((.((........)).))))))))))).)))))))}.....,))).)))))))...)))).||......,..((((((((((((({.,(((,,,.(((.(((((((((((((...))))))))))}||,|||((.((((((((,{((,{,.,,{,||}},,.....,{{((((.{{{{{||||........,,..(((......))),},,)}))))))})))}},((((((..(((((.....)))))..)))))))))))))).))....))))))}....,}))))}}})))))))))))))))((((({{(((({{(,(({{{.||||..,,||(((((((.,....}|}((.(((((.((((....(((((((((((((((.((((.(((((((.........((((((((((((....))))))))))))(((((...(((((((.(.{{(,........}))...).)))))))))))).(((((((..((((.((((((({((({(((....(((((..........)))))((((....((((((((.((,{{((((((((((((.((((((((.((.((((((,...,)))))){(({..,...}}}},....,.,..|||{(({.(.(((.(((((.......))))).))).),))).,,,.....)).)))))))).)))))...))))))))))))))))))...)))).)}})}}((((.(((((..((((.....))))...))))).)))).....(((((({..(((...)))))))).))(((((.((....)).)))))..((((((..,,......,,)))))){(((((...))))))))))).))))))..))))))))))).))).))))))))))).)))))))))))).))))),))..((((,..((((((((..(((((.((((.((((,,({{,.{(((.{(((.....)))|.)))||}|.{{.{,,{|,...|||.,.,}|.,...,..))}}))|((((((((,(((({.,....|||||,}}}|,,||)}|}}))).}))).)))))...))))))))...)))).(((.(((((...))))).)))..,...,{((((((((........,.....))))),,,,,))))((((((((((.,....}.))))))))))..})))))......,,},},))))}.}}}}}......{{...}|,}}||}}}}|(((((((.(((((((((......)))))).))).))))))){{{{....((.((({{((((((((((..,{{((,,.{(((({{...,,.,.|||},||||((({........}))}.{{(((((....(({,(({({,,,,,((((((,(((((((......,.))))))).,.....))))))..,{{|{{{,((.((({{,..,||||,{((((,((.(((.((((((......))))))))).)}}))).||,,..{{,||||,|.,.}}})))},},,..{(({((({(((((,.|,..{{(.,(((.((((((,{|.{(((((((((((.(((.(((((((((.....)))))....(((((........))))))))).)))))).)))))))).....))},.)))))).)))...)}),.,,.)))))},,...}}}})}){{{{({..{{...))..)))))}.{(((...)))}|||}}..}))...))))))).....,..)))))))))))))).)),,|{||||...||||,,.........|}||}|,,.,,..||.|.{||||....)))))})})}.,}}||,.((((((((((((,..,|.{((((((((((.({,.,.,|{{|{..,..|,}||,,.,}}}...(((({......)))))}}||||.,...,))))|(((....))))...}).))))).)))))}}}.,))))))))))))}}))).)).))))))).}...))))....))))))))..(((((.....)))))(((.((....(((((((.({....}).)))))))......))))),((((((,.....)))))},,...))))))))))..)))|||{..,,||(((((((((..(((.((((.(((((((......)))..(((((((((((..{{{.{{{.{{{{{(((((((.(((.(((.......))).))).)))))))|{.(((((((((((((.((,..,,,.....(((((.{{....,,{{({((,,.....}}))}((((.((((.(((((((((((...,({((((((,((|,{{{{{|,,.,..})))),)).,,(((((.((((((....)))))).))).)).{{{{{{,(((((.(((.....))).))))){{{{|,,,.,,)))}},}))))}||||..,,}|||,,,.}},)))))}}}(((((((...(((({,{,....)))))},)))))))..((((((.(((((((((..((((.((.........))}}))....)))))}.....,)).).)))))).))))))}})))).)))))))))})))))......,,..)).))).))))).))))).)}}|||{||}}}|{{|||||{.{||||||{{{|....)))).}}))}.||||}||{{.....)))|)..,,)))).)))))))........)))).)))).))){({({{((({..||}..)))),}},,....)))))))))|||((((.....)))),})}))))))))},))}...{,{{{{{{.{....),))))))},,,.,{{{{(({..,.)}}))}}.,.....))))))).))),).))))))).},).))))))..,.))).......))))))))))))),

Transcripts

ID Sequence Length GC content
ACUUCCUGGCAAUUCUAGCCACCAUGAGUCCAGGGGCUAUAGCCCUUUG… 3479 nt 0.6079
Summary

This gene encodes a member of the integrin alpha chain family of proteins. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate through disulfide linkages to form a subunit of the alpha-IIb/beta-3 integrin cell adhesion receptor. This receptor plays a crucial role in the blood coagulation system, by mediating platelet aggregation. Mutations in this gene are associated with platelet-type bleeding disorders, which are characterized by a failure of platelet aggregation, including Glanzmann thrombasthenia. [provided by RefSeq, Jan 2016]

Forensic Context

A study in humans demonstrated that the ITGA2B gene was upregulated in circulating leukocytes from adult burn patients with burn sizes exceeding 40% total body surface area, showing a fold change of 2.05 [Sood et al. DOI:10.0000000000000905]. Another study in humans found that the ITGA2B mRNA was upregulated in circulating platelets during sepsis and in lipopolysaccharide-activated MEG-01 megakaryoblastic cell cultures [Szilágyi et al. DOI:10.3390/ijms21030866].