Basic Information

Symbol
ITGA5
RNA class
mRNA
Alias
Integrin Subunit Alpha 5 CD49e FNRA Integrin, Alpha 5 (Fibronectin Receptor, Alpha Polypeptide) Fibronectin Receptor, Alpha Polypeptide Fibronectin Receptor Subunit Alpha CD49 Antigen-Like Family Member E Integrin Alpha-5 Integrin Alpha-F VLA-5 Very Late Activation Protein 5, Alpha Subunit Fibronectin Receptor, Alpha Subunit ITGA5/SLC9B1 Fusion CD49e Antigen VLA5A
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_002205.5
Sequence length
4250.0 nt
GC content
0.5805

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1709.40 kcal/mol
Thermodynamic ensemble
Free energy: -1782.11 kcal/mol
Frequency: 0.0000
Diversity: 1206.54
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((...(((((..(((...((....(((.(.((((((((((..(((((..(((((((.(((((((...(((((((..((((......)))).))))))))))).)))((((.(((((((((((..(((.((((.....(((((((((.((((.(((...(.((..(((.(((((......)).))).)))..)).)...))))))).)))...))))))....)))).)))...))))(((......)))..))))))).)))).....(((.((((...((.((((((((((((((((((((((.((((((((((......))))..((((((..((((.(((((..(((((((....((.......(((((((..((........)))))))))....))....)))))))...))))))))))))))).(((((..((((((((((....(((.((((...((((((((...........((((((.(((((((.....((((.((....((((((((...((((....((((((...((....))..))))))..))))))))))))))))))..))))).)).)).)))).....))))))))....)))).)))(((.((((.(((..(((...))).))))))).))))))))))))).)))))..(((....)))((((.(((......)))((((((((((.((((((((..(((((((..(((((((.((((.......((((((...)))))))))))))))))((((.((...(((((....)))))......)).)))).((((((((...))).))))).((....)))))).)))..)))))))).((((...))))((((((((..((....))..)))))))))))))))))).((((((((((((.((....)).))))((((..((((((...))).....)))...))))...))))))))))))...((((((((((.....((((.((.....(((((.(((((((((..(((((.....((((((((.((.((((...))))...((((......))))((((((.((.((.((.((((((.(...((((((((.........((((((((.((....))))))).)))))))))))....).)))))).)))))).))))))(((.(((((((((.((((.((....((((...((((((.........))))))..((((....(((..(.((((....)))).)..)))))))((((((((((....)))))))))).(((((((((.....)))))).)))..(((((((((.......)))))))))))))....)).))))))))))))).))).((((((((((((...(((((((((((.....))).))).....((((((((((((((((((((((((.(((......)))(((((........)))))...((((((((((((((....((((.((....((((((((((.(((.(((((.(((((((.(((((((((.(((((((.(((..(..((((...((((.(((((..(((((((.((((((((((((.(((.((((...)))).))).)))).........))).))))).......)))))))..........(((((.(((((((......)))))))...)))))))))))))).))))..)..))).))))))))))))))))....(((((...)))))((((....)))).........(((......))).)))))))..((((((.(((.((((.((((.........(((......)))...(((((.(((((.....)))))..))))).)))).))))))))))))).((((....))))))))).)))....)))))))))))).))))))))))))..))))))((....)).((...((((((.(((((((((....((((((.(((((((......(((.(((((.((((.((((((((((((..((((..(((((((................((((.........))))....((((....((((.((((((((((.((((((.(((((.((...((((.((((((((..((((((..(((((((.(((((((.((.(((.((.......((((((((((((....(((...(((((((((..((((((.((((.((((....(((...(.((((((((((.((((.((((.(((((((((.(((....)))..)).))))))).))))..))))))))(((((........))))).................(((((.....)))))..)))))).)...)))......))))...)))).))))))(((...(((....))).))))))))))))..)))...)))))...)))))))...((((((...))).)))....(((((.....)))))....)).))))))))))))....))))).))...(((((.((((((.((.....((((.(((.....)))....))))......((((..((((.(((...((((.....))))....))).)))).)))).)).)))))).)))))...)))))).))))).)))..))))...)).)))))..))))))))))..(((...))).)))).))))))....)))))))))))))))..)))))......(((((((....(((....)))..)))))))((((...((((...))))....))))..(((((.(((((((..(((((((((((.(((..((((.((.........)).).)))..))).)))))).........((((((......))))))....))))).))))))))))))........))))).)).))))..........(((((...(((((.((........((((....))))...........)).))))).)).)))))))).)))....((((((..(((((.(((((((.(((((..........((((....))))..)))))...)))..)))).)))))....))))))............))))))).(((((((....))....(((...(((...(((((...))))))))...)))......))))).))))))....))))).))))..))))))))....((((.(.((..(((..((((..((((.((((((....(((......)))...)).)))).))))...))))..))))).))))).(((..((((((......))))))..)))..........))))))))).)))))))))))))))..(((((((((((....))))).......(((((((((((.(((.(((..........((.((((((..(.(((((((((...(((((((.(((((((..(((.....)))..)))))))..)))))))))))))))).)..))...)))).))..))).)))...))).))))))))....((((((((.(((.......((((.....)))).((........))....(((((((((.(((.(((((((((.((((.....((((((((((((......)))...)))))).)))......))).).)))))).)))......(((((.(.((((.((.((........)).))..)))).).)))))....))).))))))))).((......))....)))))))))))((((.....)))))))))).)))))...)))))))....)))))(((((((...(((((((((((.((....(((((...)))))))))))).(((((.(((((..((((..((.(............((((((...(((((........)))))))))))).))..))))..)))))....)))))......)))))).(((....)))((((...))))....))))))).......)).))))))))...)))))....))))))))).)))))))))))......))).)))))))........)))))).)).))))))))).)))))).....)))))))...)))).))).....)))))))..)).)))..)))........................((((((....))))))...))))))).).))))).)))..)))))....)))
Thermodynamic Ensemble Prediction
..{{...(((((..(((,,,((..,.(({,(,((((((((((,,{,(((..(((((((.(.(((({...(((((((..((((......)))).))))))).((((((.((((.((((((((((({{(((.(({,.....((,((,((.((,((.,,.,}.|},|}.||,}|{|{,.....}))})))})))..},.....},|,|||.|||{{{}|,||,...,)}))}))).}})})}(((......)))..))))))).)))).)),}))).(((({{{(,.((((((,(((({((((({((,(,,{{{,.((((......))))..((((((,.{(((.(((((..(((((((....{{.,{,..,(((((((,.{{........)}))))))),,..)}....)))))))...})))))))))))))).(((((..((((((((((....(((.((((.,.((((((((....,{.....((((((,({(((((,....(({{,{{....((((((((...((((,,..((((({,,.,{....}}..)))))),,)))})))))))))))})),.))))).}}.)}}})))...,,))))))))....)))).)))(((.((({{(((..(({...})).))))))).))))))))))))).))))).{((({.,{({,.,((.(((((({{{,||,,(((((((({((((({{,..,||||||}.||||||}.,||,.,,,,,{(((((({{{||||||||}|||||||},{,,.{{.||||{((,{{{,}}}}..,,.{||{||||.(({,{||..{{{||{||,||{(({{{{||.||,.,||,,||},}|||,((((...))))((((((((..((....))..))))))))}||||,,|||{(.(((..(((((({,......,,,|(((((((((((....((((((({{|..,,,.(((..(((((((...,.....((,,{{,{{{{{{..(((((..{{.,{((((((((,(.(((((((,,{(,,,..,.{((((({...||||}},{{{|{{.((((......))))((((((.((.({{((.((((((.(...(((((((({........,(((((((.((....))))))).)))))))))))....).)))))).)))))).))))))(((.(((((((((.((((.{(,,..((((,.(((((((.,..((((,..(((,...,)))})))).....((((....))))...})).))))((((((((((....)))))))))),(({((((((.....)))))).)))..{((((((((.......)))))))))))))...,)).))))))))))))).)))...(((((((((,,.((((((,.((((((..{((({.............,.})))}))))))..,,})).))).}}))))))),,{{{...{{.,.,}}{{.((((((((((((((....((((.((....((((((((((.{{(.(((((.(((((((.(((((((((.(((((,(((((.{(.{(({(...((((.(((((..((((((({((((((((((((.(((.((((...)))).))).))))}........,))}})))).},....}))))))..........(((((.(((((((......)))))))...)))))))))))))).)}}).})}.))))))))))))))))))))....{((((...}}})|((((....,|||...}}}..,|||,.....}}).)))))))..((((((.(((.((((.((((..,.,,...(((......)))...({({{.(((((.....)))))..))))).)))).))))))))))))).((((....))))))))).}))....)))))))))))).))))))))))))..)))))).)}.{{{{{,,...,,,,,,..||}||,,|,,},||||,,}|||||||..}....})))))).,.)))}|,,....,,,|}})))}}..}))}},,.}},..,},},...}.,))))))}.....))).}}}.,{{{...,((((.((((,{((((.((((((.(((((.((...((((.((((((((..((((((..(((((((.(((((((.((.((((((.((.,..((((((((((((.,,,{,,...(((((((((.,.((......((((.{({,,,((({{{(,{(((({|,(({((((.((((.(((((((({.(((....)))..)).))))))).))))..)))))))}(((((........)))))....,{.,{{{,.....||||{.....,||||..|}}}},.}...,}.......((((...)))).))))))).,}}.)))).....)).}.)))))))))..})),..)))))...))))))).,.)))))))),{,((((({.{,.,,,,..),})}))}},,.......)))))))))....))))).))...(((((.((((((.((.,,..{,,,,{({,....},......}}|....|,{{{{..((((.(((...((((,...,))))...}))}.)))).)))}.)).)))))).)))))...)))))).))))).)))..))))...)).)))))..))))))))))..,,,...)))},)))})}}))}....))))))))))))))},))))))),....{((((((....(((....)))..))))))}((((...((((...))))....)))),.(((((.(((((((..(((((((((((.(((..(((,{((,......,.}).).)))..))).}))))).........((((((......))))))....))))).))))))))))))....{((((.,,...,.))))))))).))..)))))))}..,}}}.....}}},}}}}}.)},))))))))))}....||,|{||||||||{|,,,||{||}||..{(((((.{(((((.(((({((.(((((,|,,......||||....}}}}..)))))...)),..)))).))))},}}.)))))}...........,|.,,.,..|{{{|||,..,,},...|||...{{(,..(((((...)))))))}...})).,,}}},,,}}.,,,.))}}}}}}}))}))}|{.(({||,......{(((.{.|({.(((..((((..((((.((((((....(({......}))...)).)))).))))...))))..))))).})))}.(((..((((((......))))))..))),.,.,.....}))),)))))}})))))))))))))}}||{|||{|(({....,,,{|(((({.,{{{(((((((,....{((....}}}.....}}}}}}}),)})))||,{{{{.,,{{(((((.{{{((((..{{|,,,,,)))..))|||||{,,,||||||}}|||||,.,..,....,))},,,..,||{}||{,.,,,.}}},,}}}||,{(((((,,....,}}}.}}}|||{.....)))),|)))),,.,))))},}|||||{{{{.,||}|||||||||,|,,,...}}||||{||{||,,..,,,})||..{||||||{|||....{{|||{.,||||||.,,|,,|,..(((((,({((({.{{.((........)}.}}..|||}.|||}})}.{{{|||,}}},}}}}}.{{......))...,,,)))))))},||||}}}},))}},,}|||.}}}}|,.,|||||||....,,(((((,,,((({(..(.(((((((({((((((((((...))))).)))}.,.,{((,.,|,,,.}|||({,{.,{((({.......}||||||}}}}||||}}}}.}..))))))))))))}}}..}))},,}},})}}..))))}}},}}})))})).,}|{{,,((..(((.({(,.......))))))..)))))))})}))))))}}}.))))))..)))))))),,||||.||||||{{.{{.|||,||}|||,.{{{{{{{,,,,))}))}),,)))))}.)))})),.}}}.))))),.}}))).,))))..,.)))))))..))).))},)),....,,,.}},,,...,,,,,,}.((((((....))))))...||}}}}|,|,|}},}}))),.)))))....)).

Transcripts

ID Sequence Length GC content
AUUCGCCUCUGGGAGGUUUAGGAAGCGGCUCCGGGUCGGUGGCCCCAGG… 4250 nt 0.5805
Summary

The product of this gene belongs to the integrin alpha chain family. Integrins are heterodimeric integral membrane proteins composed of an alpha subunit and a beta subunit that function in cell surface adhesion and signaling. The encoded preproprotein is proteolytically processed to generate light and heavy chains that comprise the alpha 5 subunit. This subunit associates with the beta 1 subunit to form a fibronectin receptor. This integrin may promote tumor invasion, and higher expression of this gene may be correlated with shorter survival time in lung cancer patients. Note that the integrin alpha 5 and integrin alpha V subunits are encoded by distinct genes. [provided by RefSeq, Oct 2015]

Forensic Context

A study in rats demonstrated that blast-induced traumatic brain injury upregulates the ITGA5 mRNA, a marker of the integrin pathway, with expression increasing in relation to both blast intensity and time after the blast exposure [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].