Basic Information

Symbol
ITGAE
RNA class
mRNA
Alias
Integrin Subunit Alpha E HUMINAE CD103 Integrin, Alpha E (Antigen CD103, Human Mucosal Lymphocyte Antigen 1; Alpha Polypeptide) Human Mucosal Lymphocyte Antigen 1, Alpha Polypeptide Mucosal Lymphocyte 1 Antigen Integrin Alpha-IEL Integrin Alpha-E HML-1 Antigen Antigen CD103, Human Mucosal Lymphocyte Antigen 1; Alpha Polypeptide Antigen CD103 CD103 Antigen
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_002208.5
Sequence length
3803.0 nt
GC content
0.5461

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1424.00 kcal/mol
Thermodynamic ensemble
Free energy: -1490.27 kcal/mol
Frequency: 0.0000
Diversity: 858.00
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((.......(((((.......)))))..((((((((((..(((.(((((.....))))).((((((((.(....((((((((((...(((((((((.((((...)))).)))).)))))...(((....)))..((((((.((..((((((.(((((.(((((((.((((((((((......(((((((...((((((((.((((((..((................))..)))))))))....(((.((.(((((...(((((((((((((((((((((......))))))....(((((........)))))(((((((((..((..(((.....))).))..)).))))))).......((((....))))(((((((((..((((.(..((((...((((..((((.((((.......))))..))))..))))(((((.(((((.(((....)))....(((((..((((......(((((...((((((.....((((..(((.((....((.((((.((..........)).))))))....)).)))..)))).(((.(((...))).)))))))))..)))))))))..)))))...)).)))))))).....))))..)..))))..))))).)))).))))....)))))))))))(((((.(((((..(((......))).)))))...))))).......(((((........)))))))))).)).)))...)).)))))).))))........))))))))))...)).)))))....(((((...))))).(((((.(((...(((((((((((((..((..(((....)))...))..))))))...(((((((.(((((.((((...(((((...((((((.....(.(((((.((((...(((.(((..(((....)))..))).)))...((((((..((((((.(((((.(((((..(((.(((((....((((....))))..((((.((.(((((....((((((((((...(((((((((...)))))))))..))))))................)))).....)))))))))))........((((.....))))....((.......))))))).))).))))).).))))))))))..)))))).))))))))))..((....))............)))))).)))))...)))).))))).))))))).....(((((((.((......)).)))).))))))))))..(((((((....)))))))((((((.((.(((((.......))))).))..))))))((((...(((((.(((.(((((((..((((((..(((...)))..))))))..)))))))....)))(((((((((((((((.(((((...(....)...))))).))))))).........)))))))).(((.......)))(((((((.(((......))).)))))))))))).))))))).))))).))))))))))).)).))))))))))).)))))..).)))))))).((((.((......))))))(((((.((.((((((..(((..((((((((((....(((((((((((...((((((((.(((((............)))))(((((.(((((((.((..((((((.(((.(((.((((.((((((((((((.((((((((.(((((.((..((((((...((((((((.(((..(((.(((.((((...)))).))))))..))).))))))......))....))))))))))))))))...((((((.((.((((.((((((((((((........)))).(((((..((((((.(((.......))).)))))).)).)))...(((((..((.....)).))))))))))))))))).)).)))))).((((.((........))...))))..((((((((((((((((((...((((...(((((((((.((......)).))))....))))).(((((.......)))))...((((.((((...(((....)))..))))))))..(((((((((.(((..(((((.(((((((.(((((((.....))).))))((((((((.((.....((.(((((.((....((((((......(((((...))))).((((((.((.((.(((.....))))).)).))))))))))))....)).))))).)))))))))))))))))))..))))))))))).))).)))((((((.((.(((((......)).)))))..)))))).....(((((((......))))))).((((((....))))))...)))))))))))....))))))))))).(((....)))))))).))).)))))))))...))...)))))))).).)))))..))..))))))).)))))))))))))....))))))..((((((....(((((.....(((((...(((((...((((((((..(((((((.(((...(((((((((((.((((((((((..((((..........................))))((((..(((((...((((.....)))).....))))).))))......(((...(((.((((((.((....)).).))))).))).....)))))))).))))).((((((((((((.((((((((.........((.(((((.((....)).)))))))((((((..(((.(((..(((((((....)))).)))..))).)))..)))))).....)))))))).)).))..)))).).))))))))))))))..))).)))))))...))))))))................))))).))))))))))..)))))).))))).....)))))))...)))..)))..)))))).))..)))))(((........)))....((((.((((....))))))))..)))..))))))))))(((((((.((..((((((.((....))))))))....(((((((((((((((((((......(((((..((((.(....)))))((((((((((.((((....)))).)))))).)))).(.((((((((((((....(((((.......(((((((((((((.........)))).....(((((.....((((((.((((((((......(((.(((....))).)))((((((........))))))...))))))..)).))))))....))))).......((((.....)))).)))))))))......))))))))))..))..))))))((((((((((((.((.((((((.((((((.((((((...........)))))).)..))))))))))).)).))...........((.((.(((.(((((..(((((..(((((....)))))..)).)))..)))))..))))).)))))))))))).))))).....((((...))))(((......))).........)))))))...((((((..((((...))))..))))))))))))))))))((((.(((.((((.(((..((.(((....))).))..))).))))...))))))).((((.(((........))).)))).......(((...((((..((.((((...))))...))...)))).)))..)).)))))))......................))).
Thermodynamic Ensemble Prediction
(((.......(((((.......)))))..{(((((((((({,((.(((((.....))))),}|)}}|..(({.,(((({,,|{({,..||,((((((.((({...}))).)))))).|||{{{((({{{.||{{((({,(((.(((((..((.(((((..{((((({(({{{{..||,..{{((({(......,..,|{{({((((((,.,,.,{{,.....,,....))..}}}}))))}(((((.(((.{.(((((((,(((((((((..,,,,,{|.,|}}}}}},,{{((,{,(((((........))))){((((((((..((..(((.....))).))..)).)))))}},.||,,.||,,,,..}}|||{||{{(({|||,||,|.|||||.||{{,{..{{,({((||..}}},.}|||{||||||{{{,,(((((.{(,(({({{||,,}||..(((((((,.((,,.....(((((.(..((((.((....)).))))..).))))}.(((,...}},........}},})))))))))..,.,}},..,,,|{{{.|||..,))),)))))))},},.)))))}))}})..},},,))}))))),)),,,})))))))).{|(((({({((((..{....,{(((.{{.,,{{{{{{(((((.(((((..{((......))}.)))))...)))))}....(((((((........))))))).,{{|{{.,....|,{{{.|{{{{,(|,....}}})))))|))}|,.,|||||,,,.{({(({.((({({{{(,((.,.,}}.,}|||||{{|{{|||{|,{||,|||,.,.))).,})}.,})))}}},.(((((((.(((((.((((...(((((...((((((.....(.(((((.((((.,{(((.(((..(((....)))..))).))),},((((((..((((({,(((((.(((((..(((.(((((....((((....))))..((((.((.(((((.,,..(((((((..((((((((((((...))))))))},)))..)).)))))..},......,,,,.,,..)))))))}))}..,,,,..{,,,,,..,|||}....||.},}}..,.))))).))).))))).},})))))))))..)))))).)))))))))}..,,.,.|||............)))))).)))))...)))).))))).))))))).{{{{{{|{{{{.{{.,||..)),}}))|))).,.))))|}(((((((....))))))){(((((.((.(((((.......))))).)).})))))}((((...(((((.{((.(((((((..((((((..(((...)))..))))))..)))))))...,}||(((((((((((((((.(((((..,(....}.,.))))).))))))).........))))))))}((,.......))}(((((((.(((......))).)))))))))))).)))))))))...)},)))),.).,))))))))))),)),))))))))))))))))))).)))))))).,}}}))},,))})))}||}((((((..(((..((((((((((..({({((,((((((,..((((((((,(((((...,,...,,..)))))|((((.(((((((.((..(((((,,(((.(((.((((.((((((((((((.((((((((.(((((.((,.{(((((.,,((((((((.(({.,(,(((((.((((...)))).)))))}.,))),))))))......))....)))))))))))))))),..((((((.((.((({,((((((({((((........)))).(((,,..((((((.(((.......))).)))))).}}.)))...(((((..((.....)).))))),))))))))))).)).)))))).((((.((........))...))))..(((((((((((((((((({.,(((((,,{(({,((((.((......)).))))....|||||.(((((.......)))))...))))}},|},,}))){(((((((.....)))))))|{((((((.(((..(((((.(((((((,(((((((.....))).))))|((((((((((.....((.(((((.((....((((((......(((((...))))).((((((.(({(({((,....,))))).)).))))))))))))....)).))))).))))))))))),)))))))..))))))))))).))).|||((((((.((.(((((......)).)))}),.))))))..}}.(((((((......))))))).((((({....))))))...)),)))))))),...})))))))))).(((....)))})))).))).)))))))))...))...)))))))).).)))))..))..))))))).))))}))))))))...,)))))).}||||,{,,,.,{{{{{{{{{{{,..|||||{{,.|,((((((((..(((((((.(((...(((((((((({.((((((((((.(((((((..(((,(,.................}},))),.)).))))).((((.....))))...,{{,,,.....|||....|||..{(((.((((((.((....)).),))))).))},}.,.}}}))))).))))).((((((((((((.((((((((.........((.(((((.((....)).))))))){(((({,,(((.(((..(((((((....}))).)))..))).))).,)))))).....)))))))).)).))..)))).).)))}))))))))))..))).)))))))...)))))))){{{..{,,...{{{.......,))..}))}))},}))})),))))).,...)))))))...)))..)))..)))))),}|||||},{{{{.....,,,|||,..,||||{((({....}))))))),..,))}}))))))))|(((((((.((..((((((.((....))))))))....(((((((((((((((((((,,....,((((,.{{((,(....||}}}((((((((((.((((....)))).))))))}}))).|,,{|||||{{{{|,,,.(((((.......((((((((({({{.{,,....}))}},.,..{((((.....((((((.((((((((....,,(((.(((....))).)))|(((((........)))))}...))))))..)).))))))....))))).......,(((,....)))),)))))))))......)))))}},}}..}}{{||||,.(((((((((({(.((.((((((.(((({{.((((((...........)))))).}..))))))))))).)).)}(({{,......||}||.(((.(((((.,(((((..(((((....)))))..)),})).,)))))..))),,.,,)))))))))).)))})},...|{{{...})))(((......))).....,..,)))))))...((((((..((((...))))..))))))))))))))))))|,{{.((({,{({.(((,,((,({{..,,}||,|,.,}||,||||,..}}}))))|(((({(((.......}))).)))).|{{,{.,.|....|||}}||}{{||,,.))})}}}))}},,),,,))}..)).))))))),.....................))).

Transcripts

ID Sequence Length GC content
GCACUCGCCUCGGCUCCCACACAGCCGCCUCUGCUCCAGCAAGGAUGUG… 3803 nt 0.5461
Summary

Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human skin tissue demonstrated that burn injury is associated with a significant shift in T cell phenotype from tissue-resident to circulating, characterized by lower gene and protein expression of the tissue residency marker ITGAE (encoding CD103) in T cells from burn tissue compared to non-burn tissue [Labuz et al. DOI:10.7554/eLife.82626]. This was corroborated by a lower frequency of CD103+CD69+ T cells via flow cytometry, indicating altered tissue retention and homing receptor profiles post-injury.