Basic Information

Symbol
ITGAL
RNA class
mRNA
Alias
Integrin Subunit Alpha L LFA-1 LFA1A CD11A Integrin, Alpha L (Antigen CD11A (P180), Lymphocyte Function-Associated Antigen 1; Alpha Polypeptide) Lymphocyte Function-Associated Antigen 1, Alpha Polypeptide Leukocyte Function-Associated Molecule 1 Alpha Chain Leukocyte Adhesion Glycoprotein LFA-1 Alpha Chain CD11 Antigen-Like Family Member A Integrin Alpha-L LFA-1A Antigen CD11A (P180), Lymphocyte Function-Associated Antigen 1, Alpha Polypeptide Integrin Gene Promoter Antigen CD11A (P180) CD11a Antigen LFA-1 Alpha
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Cause of death analysis

MANE select

Transcript ID
NM_002209.3
Sequence length
5129.0 nt
GC content
0.5525

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1962.17 kcal/mol
Thermodynamic ensemble
Free energy: -2047.24 kcal/mol
Frequency: 0.0000
Diversity: 1207.90
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.........((((((((........(((((.(((((...(((....(((.((((...((((((((((.(((..((((((((((((.((.((...((((((.(..((.(((((((..((((((((....((((((..((..(((..(((........(.(((((((((.((((.(..((((((..((((((((((((((((..((((((...........))))))..))))).....)))))))))))((((((...(((((((.(((.((.(((.((((((..(.((....((.(((((.((.((((((.(((((.....))))).((...(((..((((((((((((((.(((((.........))))))).......)))..))))..))))).)))...))...)))))).)).))))))))).)..))))))))).)).)))..(.((((((((..((((.....).)))..))).)))))).((((((((((..(((((...(((((........)))))((((((((...((....)).))).)))))...))))).)))).......(((((.(((.....(((((..(((((.(((((((.((((((....)))))).)))((((((....((.(((......))).))...))))))....))))))))).))))).....)))))))).....((((.(((((((....))))))).))))...)))))))))))))((((((....).)))))....((((.....)))).)))))).(((((((((..(((((.....)))..))..)))))))))))))))..))))).)))).)))))))))..))).)).)))))).....))))))))((((.....((((((...))))))..)))))))))))...))..).))))))....)).)))))(((((....(((.(((((((((((.((((.(((....))).))))((((((((((.((.........))))))))))))........))).....)))))))))))....)))))....((((((((((.((.((((.(((((((...((((((...(((((.........)).)))))))))))))))).)).)).))..))))).)))))((((....))))))))))).))..))).)))))))))))))))))..)))....))))).)))))........)))))).))....(((((((..((((((((((((.((((...))))..((((.(((((((((((.....(((((((((...(((((((((((((.((((((((((........((((((((((..(((((.....)))))..)))))).)))))))).((.(((..((((...))))..))).))))))).....).)))))))))..........)))))))))))))..)))))))))))))))(((((((((.(((.((.((.(((.(..(((((((((((...(((((....(((....((.(((((........))))).)).(((((.((((..((((((.....(((((((..(((((..((((...((..(((.(((((..((.(((((((.((((.((...(((((((((((((.(((.....)))..)))))))...(((.((((......))))..)))...)).))))..)).)))).))))))).))..((((((((((.(.((.(((((((.(((.(((((((((((((((.(((((...((........))......)))))(((..((.((....))...)).)))((((.(((((((((....(((((((((((..((((.((((((((..(((..(((((((..((((((((((.(((((((.........))).)))).))))))..(((((......)))))((((((((((((.......(((((....((((((((((.((((.((((((((.((((.............))))...))))))..)).)))).......((((((.(((.(((((((.(((...........(((((.((((((((..................)))))))).))))).(((..........)))(((.....))).)))))))))).))).)).....))))....((((.......))))...))))))))))..((((((((((((.....(((..((((....((((...((.((((((.....((.(((((...((((((((...))))))))..))))).)).(((((......(((((((((((..((.....))((((((.((.....(((((((((((((((((....(((....))))))))))......))))))))))......)).))).)))......(((((.......)))))(((.......))).)))))))))))..((((....).))).)))))...(((((((.(((.((((.(((((.((((.((((((..(((((...(((((((((((((.((((((.(((((......)))))...)).)))).))).((((((((.((((((........)).)))).).)).)))))....)).))))).)))....))))))))))).)))).))).))..))))...(((((.((.(((((.((....))))))).)).))))).(((.....)))..)))...)))))))))))))))...)))).....)))))))...))))........))))))))))))).......))))))))..))))))))..))).)))).)))..)))).)))).))))..)))).......(((..(((...........)))..)))....)))))))..(((((.....((((((((..((((......)).))..)))..)))))..)))))....................(((..(((((((((((((((......)))))))))).)))).)..)))..............))))))))).))))..)))))))))))).))).)))...))))))).)).)..)))))))...)))..))))).))).)).))))(((((...)))))(((((.(....((((((..(((((.(((.....((((.....(((((((....((((..(((((((((........))))))))))))).((((((((((((((.(((...(((((((((...(((((((.(((.((.((((.(((((((((...(((.....)))....))))))))).)))).)).))).)(((((((((((....))).....))).)))))(((((((((.(((.((....)).))).))))))))).........))))))........((((((.......)))))))))))))))))).))).))).))))))))))))))).)))))))))))).))))))...).))))).((((((..((((((((((((((((....((((......))))...(((((((..((((((((..((.((.((((((((((((.((((((((..(((...(((((...))))))))..))))))))(((((((.((((((......))).)))...)))))))((.(((((((....))))...))).)).((((.((((((((((((((((((((.........((((....)))).((((((.......))))))..)))))))).....)))))))).))))((((((((((((.....((((..(((.(((.......))))))))))))))).))))))).((((......))))))))...((((........((((((..(((((.((((((((...(((((.((..........)).))))).))))))))....)))).)..))))))....))))....)))))))).)))).))))....)))))))).(((((...((((((.((..(((((..(((...((((((((.........))))))))))).)))))....(((((.((......)).)))))....)).))))))...........))))).)))))))...))))))))))))).....)))..))))))...)))))....))))))))))))).))))))))).)))....))))))))))))))))..).)))))))))).)))))))))(((((((.(((((((......((((((((((.(((((.((((...((..((((((.((.((...)).))))))))..))...................(((((((((......(((((..........((.(((.(((((.((.((((.((((((((((((..((((...........((((((.(((..((.(((((((((((((((.....(((((.......))))).....))))))..))))).)))).))..)))))))))))))...)))))))))))..).)))).)).......((((((..((.......))..))))))))))).)))))....))))))).)))))))....((((((((((.(((....((((((....))))))......)).).))))))))))...)))))))))...))))...((((((...............................))))))..))))))........(((((....)))))...))))))).))))))).............(((((((((((((((.(((((((.((((....)).)))))))))..)).((..(((((.......(((((...)))))........................(((((.(((((...((((.(((((....))).)).))))......)))))))))))))))..))))))).....))))))))...(((((.((((((((.((((..(((((....((......))....)))))..))))..........((((.((....)).)))))))))).)).)).))).......))))))))))))..)))))))...
Thermodynamic Ensemble Prediction
.........{{((((((....{{,.(((((.(((((..,(((....((,{((((...((((((((((.(((..(((((((((((({((.((,..((((((.(..((.(((((((.,((((((((....((((((..,{..{((..{{{........{.(((((((((.((((.(..(((((({.((((((((((((((((..((((((..,.....}..))))))..))))).....))))))))))),|||{....(((((((.(((.((.(((.((((((..(.({.,,,({.(((((.((.((((((.(((((.....))))).((...(((..((((((((((((((.(((((.........))))))).......)))..))))..))))).)))...}}...)))))).)).)))))}})),)..))))))))).)).)))..{.((((((((..((({.....).)))..))).))))),.(((((((({(..((((({{.(({{{.,.,,,}})))))((((((({...{{....,}.}}},}))))...|||||.}||||,,..,,({(((.{((,,,..{||||,.{|||,|||(((((.((((((....)))))).)))||((((..{((,.(((......))).)}.}.)))))),,,,})))))))).)))}}.....)))))))).....((((.{((((((....))))))}.))))...})))))))))))),{{{({.,,.}.|||||{{..,{{|}}}}})})},},))}}{(((((((((.{((,{,,....,})..)),.)))))))))))))))..))))).))))))}))))))).,)}},,,.))))))..,..})))))))}||{,....((((({...))))))..)})))))))))...))..).)))))).,,,)).},)))(((((....(((.(((((((({{,.((((.(((....))).))))((((((((((.((.........)))))))))))),.....,,|}}.....)))))))))))....)))))....((((((((((.((.((((.(((((((...((((((...{(({,.........)).)))))))))))))))).}}.}).))..))))).)))))((((....))))))))))).))..))).)))))))))))))))))..))).,..))))).))))}....,,,.)))))).))....(((((((..(((((((((((({,{((...|,,,..((((.(((((((((((.....(((((((((...(((((((((((((.((((((((((........((((((((((..(((((.....)))))..)))))).)))))})}.((,(((.,{({{...)))).,)}},))))))).....).))))))))}.........,)))))))))))))..)))))))))))))))((({(((((,(((,((.((.((({,..,(((((((({{.,,({(((,,,.(((,,{,,{.(((((........))))).}||((({((((((.,(((({,.....{{((({(,,(((((..((((({{{.....({(((((((((((((((({.(((({((,.{((,,,,|||{||{,(((....,}}|,,}||||||{{{,((,(({(,.,,,,}}}|,{|||,.,||,|}||{|||{||||{||{|{{(..{{,{((((({{|({{,,..{((((((.(((.(((((((((((((((.(((((...((........))......))))){{..,,,.{|...,),...,..||{((((,((((((({{...,(((((((((((..((((.((((((((..(((..(((((((..((((((((((.(((((((,,....,,.))).)))).))))))..(((({......}))))((((((((((((.......(((((.,,,((((((((({.((((.{{((((((.((((.,.........}.))))...))))))..,}.))))..{(((..,.}||,(((.(((((((.(((....{{((,..(((((.((((((((..................)))))))).)))))...))},.......,}|(({....,))).)))))))))).))).}},....}},,,,,.((((.......)))).,,))))))))))..,||{{{{{{{{{.....(((.((((({{,.,(((...((,((((({.....{{.(((((...((((((((...))))))))..))))).||.(((({......(((((((((((.,(((,,,.,,((((((.((.....(((((((((((((((((....(((....))))))))))......))))))))))......)).))).)))......{{{{|,,,,,,.}}}}},,{.......),,.)))))))))))..,{((,...}|,}},)})|}.|,(((((((.(((.((((.(((((.((((.((((((..(((((.,,(((((((({{{((.{(((({.{||||.,,,,,,}||}...)).)))),}}}.((((((((.((((((,,...,},}}.)))).).)).)))))....}).)))))}}}}...}))))))))))).)))).))).))..))))...(((((.((.(((({{((....))))))).)).))))).{((.....})}..)))...)))))))))))))))...))))}}},.))),)))...)}))........}}))})))))))).......))))))))..))))))))..))).)))).)))..)))).)))).))))..)))}......,{{{..{{,,{........,}}}..)))...,)))))))..,{((({{{..((((((((..((((......)).))..))),.|))))..}}}}),,.,....,...........,|{.,{((((((((((((((......))))))))))))))).).))))}}............))))))))),)})}},))))))))))))}}}).)))...))))))}.||{{{||||||},|{.,|}|}}}}}}))}}}}))))}}||}}}},,}}}})|{{|{.{.|..||||||,,||||(.({{,|,..||||.....(((((((....((((..(((((((((........))))))))))))).((((((((((((((.(((...(((((((({,{{((({(,,.({{.{(.((((.(((((((((...(((.....)))....))))))))).)))).)|,|||,,((({((({,({....})))).}.,)),)))}}(((((((((.(((.((....)).))).))))))))).........))))))....,,,,{(((({....,,,}))))))))))))))))).))))))),})))))))))))))).,)),,))))))),)}}}}),},),))})),((({((,,(({(((((((((((((....((((......))))...(((((((..(((((((,,{{(,((.(((((((((((({((((((((..(((...(((((...))))))))..))))))))|((((((.((((((,,....)}).)))...)))))},{{.|{|{{||...,)))}.,.))).)).,|,,.((((((((((((((((((((.........((({....}))).((((({,......))))))..)))))))).....)))))))).))))((((((((((((.....((((,.{({{(((.......))))))))))))))).))))))),((((......))))}|||...|||,.,,,....((((((..,((((.((((((((...(((((.((..........)).))))).))))))))....)))).)..))))))....}))}....)))))))).)))).)))),}.}}))))))).(((((,,.((({((,{(,.,(({,.,(((.{{,,,(((((...}}}}}.,,)))))),||,,}}},.,,,({{{{.({,,,...,}.))))).|||,,.,,,))).,,.})}..,.))))).)))))))...))))))))))))).,,,,)))..))))))})}))))}..,,))))))})))}}).||||}}}}}.}))}},,))))))}}})))))))}))}},}})))))}.})}})))))||||(((({{((((,.......(((((({(({(({{{{(,{{.,.{(..((((((.((.({...}).)))))))),,}},...............{{{((,((((((.{{{.{(((((...,,.....{{.(((.(((((.((.((((.(((((((({{,,.,((({{,,.......{((((((.{(({,{{,{((((((((((((((...||{{{{{.......,,))).}}..))))))..,)))).)}))}|,..})})))))))))),}.)))))))))))..).)))).)}.......((((((..{{.......))..))))))))))).)))},....)))))),))))),))|},.||||}....||||,,,..{((((|....}))))))),,))))))))))).......)))))))))}},|||||||||}|}})|,....,,,,,,)),,,,...............((((((((((((......((((((((....))))).,)))||||{.((((({.....}))))).}}|||(((((({(({({.(((((((.((((....)).))))))))),})){((..(((((.......(((((...)))))........................(((((.(((((.{.((((.(((((....))).)).))))..,...)))))))))))))))..))),,,,....,)))))})}..)))))))))))).((,((((..(((((....{(......))....)))))..)))),,,}}}..,{{(((.,,.}}})}}))}.))))))},)}),.}}),,}}}.}))))))))))))..)))))))...

Transcripts

ID Sequence Length GC content
AUCAUUUUCCUCUUUCACCCUGUCUAGGUUGCCAGCAAAUCCCACGGGC… 4877 nt 0.5548
AUCAUUUUCCUCUUUCACCCUGUCUAGGUUGCCAGCAAAUCCCACGGGC… 5129 nt 0.5525
Summary

ITGAL encodes the integrin alpha L chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form the integrin lymphocyte function-associated antigen-1 (LFA-1), which is expressed on all leukocytes. LFA-1 plays a central role in leukocyte intercellular adhesion through interactions with its ligands, ICAMs 1-3 (intercellular adhesion molecules 1 through 3), and also functions in lymphocyte costimulatory signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the ITGAL was significantly expressed in classical monocytes from patients with acute myocardial infarction and plaque rupture, where it is involved in leucocyte-endothelial cell adhesion [Jun Qian et al. DOI:10.3389/fimmu.2022.908815]. In a separate human study on sepsis, the ITGAL was identified as one of 40 co-regulated genes differentially expressed in both the metabolome and transcriptome of sepsis patients compared to those with systemic inflammatory response syndrome [Chen et al. DOI:10.1038/s41598-024-59400-0].