Basic Information

Symbol
ITGAM
RNA class
mRNA
Alias
Integrin Subunit Alpha M MAC-1 CD11b CR3A Integrin, Alpha M (Complement Component 3 Receptor 3 Subunit) Cell Surface Glycoprotein MAC-1 Subunit Alpha Complement Component 3 Receptor 3 Subunit Macrophage-1 Antigen Alpha Subunit CD11 Antigen-Like Family Member B Leukocyte Adhesion Receptor MO1 Integrin Alpha-M CR-3 Alpha Chain Integrin, Alpha M (Complement Component Receptor 3, Alpha; Also Known As CD11b (P170), Macrophage Antigen Alpha Polypeptide) Neutrophil Adherence Receptor Alpha-M Subunit Macrophage Antigen Alpha Polypeptide Neutrophil Adherence Receptor Antigen CD11b (P170) CD11b Antigen MAC1A SLEB6 CD11B MO1A
Location (GRCh38)
16:31259967-31332892
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Cause of death analysis Mechanical injury analysis Wound age identification
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_000632.4
Sequence length
4719.0 nt
GC content
0.5431

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1764.70 kcal/mol
Thermodynamic ensemble
Free energy: -1846.73 kcal/mol
Frequency: 0.0000
Diversity: 1193.45
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((((......(((((((((.((((.(((.(((((((((......(((((...........)))))...(((((......)))))((((((((((....((((((.......((.((((.....)))).))((((..((((((((.((......)).))....)))))).))))....((((((((((.((.(.(.((((((........))).))).).)..)).)))))))))).)))))).(((.(((((((..((...))))))))).)))...((((.......))))..((((....))))(((((((..((.((((((..((((..((((.(.(((.(((....))).))).).))))..)))).....(((((((((((..(((((((.......((((.((((...((.(((.(..(((((.(((.(((((.(((((((((((((((((((((((......))...(((....)))......(((.(((((((((((...)))))(((.((((((((.((((...)))).))))))))..)))..)))))).))).((((((((.(((((....(((((((((....((((((((((...((((((..(((((((.....((((.....((.(..((((((((...(((..((((........))))...)))......))))))))..).))...........((((((....(((((..........)).)))...)))))).))))......(((..(((((.((((....(((((...(((....)))...)))))...))))))))).......)))..........)))))))))))))((((.(..((....))..).))))...((((..(((.....)))))))))))))))))..........)))))))))..)))))))))))))(((.((((((((((((.((....(((((....(((((..........((......)).(((((((..((((.((...)).))))...))...)))))((((((.....))))))...)))))))))).....)).)))))...))))))))))))))))))))))).))).)))))..))))).).)))))))).))).))((((((..(((((........)))))....)))))))))).))))((((((..((..(((((..((((((((..((((..........((((........)))).....(((((((.((((((..(((........)))..).))))).)))))))(((((............(((((((((((.....))))))))))).(((((..(((.(((((((......).)))))).)))))))).)))))..(.(((((.((((((((......(((.(((((((((((.((((((.((((.((((....(((....((((((.(((((((((...(((((((((((....((((((((((((((((.(((((......................))))))))))))))))((((.....(((((.....)))))..)))).)))))....)))..))))))))))))))))))).))))....))))))))))).))))))...)))))....((.((((((..((((((((((((((.((...(((..((((((.....))))((......))...))..)))....))))))..))))))).)))...)))))).)).)))))).)))..))))))))))))).).)))).)))))))))))))..))...))))))........)))))))..))))).))))))..))))))))...)))))))((((((.(((((((..((((.(((.(........).))).)))))))))))...)))))).)))))))))))))).))))).)))...)))).)))))))))))))))))((((((((((............(((((.(((((((((((....((((..(((.(((((.(((..((((((((((((((...(.(((((.(((((..(((.........((((((((...((........))...))))))))))).))))).......))))).)...)))))..)).)))........(((((((((.((((((((.(((((..((((.((.((((.((((((((((..((((......(((.(((((..(((..(((((..((((((((........))).)).)))...)))))..(((((....))))).....))).))))).)))(((((.(((....))))))))((((((..(((..(((((.(((............))).)))))(((.((((((((....))).))))).)))...)))))))))...)))))))))))))).))))...(((....))).((.(((((((((.((((((.(..((.(((....((((((..((((((.((((.(((((...((((((((((((................))))))))...(((....)))))))..(((((((..((((((((...))))...)))).((.((((((((((..((((........((((.((((((((((((.((((((((....)))((((((((...((((((........))....((((..((((((.....((((((....))))))....(((((((....)))))))........(((......)))....))))))..)))).....((.((((((......................)))).))))..))))...)))))))).....((((((..(((........)))..))))))..........))))).)))))))))...)))...)))).....))))..)))....)))))))))...)))))))..))))))))).))))))((..(((((((((((((...(((.((.....)).))).......((((......))))((.(((...(((.((((...)))))))...))))).)))))).))))))).))..))))))....))).))..).))))))))))..)))))))....(((((.(((((((..(((..(((((((((((...(((...)))...)))))))))))..)))..........(((.((((.(((((.(........).)))))..)))))))...(((((((((.(((..(((((((...((((((((.(....((((.........))))).))))))))((((....)))).))))))).))))))))))))((....))........))))))).))))).(((.....))).(((((.((.(((((.(((((((((((((((((((((((((((...(((((((.((((.((((.(((.....))).)))).((.(((.((...........).).))).)))))).)))))))....((((......)))))))))))).)))..))))))))))))))))..)))))))..)))))..)).)))))))))....((((((....))))))((.(((((.((.((((((((((...((((......)))).....)))))(((((((......))))))).)).))).))))))).)).)))))))).)))..)))))).((((((((.(((((((.((((....)))).))))))).)))))))).(((((...((((.((((.((((((....(((((.(((.((((((.((((((((((((....(((((((((.((.((((.(((((((..((((((.(((((((((.(((.((((....)))).))).)))))))))))(((((((((((((((((.......((.(((((((((.((((((.((.....)).)))))).))).)))).)).)).(((((((.((((((((((((((..((......))..)))))............))))))))).)))))))...((.(((((......)))))))....)))))))))))..(((((((((((..(((((.((.(((......).)).)).)))))..))..)))))))))......((((...))))))))))..))))..)))).((((...(((..((..(((((((((((((((..(((.....)))..).))))))))......(((((((.(((..((((((.(((...((((.((....(((((....................)))))...)).)))).)))...)))))).))).))))))).))))))..))..)))...))))....((((((....))))))))).)))))).)).)))))))..)))))))))))).)))))).))))))))..)))))).)))).))))...)))))..))))..))).)))))..)))..))))..))))))))))).)))))..((((.(((((.(((.(((.((((.(((((................................(((((((.....)))))))(((((....(((.((((((................)))))).)))...)))))))))).)).)).))).))))))))..))))..))))))))))............
Thermodynamic Ensemble Prediction
...((((((((......(((((((((.((((.(((.(((((((((,.{(((...)))}....,((.(((((((((((((((((.((({...}}},,.((((.((((....(((...(((((((((.....)))).))))).)))..)))).))))..{{.{{.((((...((((((..{{....(((((((.(((.(((((.{(((((........))),)}.(((.((.((((((.(((.....{|.{.(((.(((((((..{,...},))))))).))),}.((((.......)))).(((((....)))))......((((.((((..((((((((...(((((((.((((((((((((.(((((((..(((.(((...((({{({((((((.....(((,,.(((((.(((.((((...((.(((.(((....)))))).))...((((((.((((.((,((..((......)).)))).))))(((((((({(({(((((.((((({.(((((((((((((((((((.((({...}))),))))))),.(((((((...((((((,{(((((((.(((((....(((((((((....,((({(((({.((((((((..(((((((.....((((.....{(.(..((((((((.{.(((,.((((........)))).,.))}.,,...))))))))..}.))...........((((((....(((((..........)).)))..,)))))).))))......(({,.(((((.((((....(((((...(((....)))...)))))...)))))))))...|...)))..........))))))))))))))).|,|}}|,,..,}|{{|.||||{,,{{{,..|||}},}})))|||||}}}}}}}})....,,,,,.)))))))))..)))))))))))),(((.((((((((((({.((....(((((....(((((..........((......)).(((((({,.((((.((...)).)))).,.,,..})))))((((((.....))))))...)))))))))).....)).)))))...))))))))))......((((..((..(((((((((...,(((....)))((((((((((((.({..(((,.{,.,....(((((,((((((........)))))).))))),,..})))}).)))))))))))).....,.)))))))))....))..))))......{(((((.((((((..(((........)))..)}})))).))))))))))))))))))).....(((((((((((.....)))))))))))}))))))))))......(.{(((({,{.,....,)))))}.}.{(((..(((((({(((.((((.((((...{{....))...)))).)))).}}.}},|||,||..((((.((((((((((.{(({.,....}))|,.((({.(({,{(((,{(((((((((((.(((((.,.............}.}....)))))))))))))))),,|,)}))}}}|,}))).)))))))))).)))))))}))))))..))))((((((....))))))))))))....))))))..}}))))))))))))))....))))))))))))....,,)))....)))))).))..).)))...)))))).))))).))..})).)..)))))).)))))))))...)))))))).))))))))....))).)))))))).)))..((((.((.....)).))))....))))).,))}))))))).)).))))))...)))).)).)})))))))))))))}.....,))).))((((((.(((((((..((((.(((.,.,.....},.))).)))))))))))...))))))..{,,..,},,))))},)))).)))...)))).))))))))))))))))){(((((((((.{,,....,...(((((.(((((((((((..{,((((,,(({,(((((,{{{.,{{{((({{(((((({{.(.(((((.(((((..,.{.,(..{{({,((((,((,,{({....,},,))}}}),)))),,))))))))),......))))).)..,||||}..,),))),.......(((((((((,((({,(((((((({{(((.....)))))))))))|.,,..{{{.....,{{{{(((((,,..((((((((((((((({({((((((...(((((.((((((...,.....{((((....))))}.{(.{(((...((({....|}}}((((....))))((((((.((...,(((({,.,{(((({{..{{......,{(((....(((.((((((((....))).))))).)))...))))}...........,,{{(..((((.(((((.((((..((((((({((({{.((((((...{..(((((.(((.((((({(,..,,,,,,.,,,,.|}},}})))..)))..)))))......,,}))))...).)))).)))))))..})))))))).)))},,|},((((((((...})))...)))).}}.,))|}))})))))))).}))))).((((.{({(((((((((.((((((((....)))((((((((...((((((........))....((((..((((((.,,,.((((((....)))))).,..(((((((....)))))))........(((......)))....))))))..)))).....{{.((((((......................)))).))}}..))))...)))))))).....((((((..{((.....,,,}}}..)))))}..........))))).)))))))))...}}}...)))).....))))},.,,...)))))))))))...)))))).{|({,..,)),,}.))}.,)))).)))))))))))..,},}))).....,.)}))}),...,(((,,,...}}}}))}},|,..{{,{((((...)))))}}{{(|(((((((({{,(({((|(|.(({{|{,{,|{{{({{,.(({{{{.||||{||||,.||{,,,,|{||{((((.((((((({.(((,,(((((((((((...(((...)))...)))))))))))..}}}{,.....,,.,((,({{{.{{{{{,|,.......|.}})}}..))}}}}}...(((((((((.(((..(((((((...((((((((.{..{,((((.,.....,.)))),,))))))))((({....)))).))))))).)))))))))))),|})}}))}),.....))))))).))))}.{{{.....,,}.(((((.((.(((((.(((((((((((((((((((((((((((,,{{{({((({(((({(((({{{(,...,|||.}}))}|,.,||.}}}}}.......}}...)))}))),),.))|||||,|,,((((......)))))))))))).)))..)))))))))))))))},.)))))))..))))).,|,,||,||}}||||,,{{{{{{.,..))))))||},,,.}}}|}}.,},||,|,.,,{{{,...}},,))))..}.)))))|..,}|||,|||{|||{|||{|{{{{|{{|||||||||.,}}}}|{((((({.,,,}})|||||{{{{||||,,|)))})))))})))))))))))).}}}))))).}||||,|}||||.{{||,||||{|,,..{||||,|||,((((({,{{({(((((({{.{{{(((({(((({((.(,((,(((((((,{,{||((.(((((((((.(((.((((....)))).})).)))))))))}|,.,{({({(((({{((((,((((((.,{({({((((({{((({.{{,{,,{|{{||||,,..||,||||,|{{|,.(((((((.((((((((((((((..((......))..))))).........,).))))))))).)))))))...,,,(((((......)))))),.,}})),})))),),)))})))})}}))))))}})}))))}),}}|{{{(,(({|{|||||||,,.{{{,,|{((((({...,(((...)))))))).))},,|}}..,}}|{,,...,,{||,||,|,,,(((((((((((,..(((.....)))..}.)))))))))))...|||{{{{.,{{,,{{{({(,(((,..{{{|,||,}|.{{{{{...,{{,,...|,||,...,)))}}.}})).,))),)))...))))}}.,,,.,})))))}}}}},..|}}..|{{..((,{.{{|{{|((((...})))}))))).),))}}})).|}}}))}..}))))))))))),)))))),)}})))))))}))))),)))}.)))),,,)}})),.,)))..))),))))}..}}),,)))}..))))))))))).)))))..,,{,.(((((.(({.(((.{(((.{((((...{{{......,,....,,,}.,},,,||,{(((((((.....))))))){||||....{{{.{{{{{{.,...{{....,,...))}))).}},...}}}},})))),)},}),))).))))))))..}}},..)))))))))}............

Transcripts

ID Sequence Length GC content
NM_000632.4 NCBI
CCUUCUUUGCUUUGGUGGCUUCCUUGUGGUUCCUCAGUGGUGCCUGCAA… 4719 nt 0.5431
NM_001145808.2 NCBI
CCUUCUUUGCUUUGGUGGCUUCCUUGUGGUUCCUCAGUGGUGCCUGCAA… 4722 nt 0.5432
Summary

This gene encodes the integrin alpha M chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as macrophage receptor 1 ('Mac-1'), or inactivated-C3b (iC3b) receptor 3 ('CR3'). The alpha M beta 2 integrin is important in the adherence of neutrophils and monocytes to stimulated endothelium, and also in the phagocytosis of complement coated particles. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]

Forensic Context

A study in humans demonstrated that the ITGAM was highly expressed in the plasma of sepsis patients compared to those with systemic inflammatory response syndrome and was predominantly localized within macrophage lineages, as confirmed by meta-analysis of public datasets and single-cell RNA sequencing [Chen et al. DOI:10.1038/s41598-024-59400-0]. Another human study found the ITGAM was significantly upregulated in salivary extracellular vesicles from emergency department patients with acute traumatic brain injury compared to healthy participants, indicating its role in inflammation-related gene profiles for injury diagnosis and severity evaluation [Cheng et al. DOI:10.4103/1673-5374.266924]. A study in mice demonstrated that wound-infiltrating cells from both burn and non-burn cutaneous wounds were primarily CD11b+, with a significant number expressing this myeloid cell marker, though the mean fluorescent intensity was slightly but significantly reduced in cells from burn wounds [Schwacha et al. DOI:10.1016/j.jss.2008.07.034]. In a rat model of severe burn injury, the protein and mRNA levels of CD11b/c in enriched adipose-derived stem cells were not significantly different between burned and non-burned animals, indicating stability of this marker in that specific cell population post-injury [Prasai et al. DOI:10.007/s12015-017-9721-9].