Basic Information

Symbol
ITGAX
RNA class
mRNA
Alias
Integrin Subunit Alpha X CD11c Integrin, Alpha X (Complement Component 3 Receptor 4 Subunit) Integrin, Alpha X (Antigen CD11C (P150), Alpha Polypeptide) Leukocyte Adhesion Glycoprotein P150,95 Alpha Chain Complement Component 3 Receptor 4 Subunit Leukocyte Adhesion Receptor P150,95 CD11 Antigen-Like Family Member C Integrin Alpha-X Leukocyte Surface Antigen P150,95, Alpha Subunit Myeloid Membrane Antigen, Alpha Subunit P150 95 Integrin Alpha Chain Leu M5, Alpha Subunit Integrin Alpha X CD11c Antigen Leu M5 SLEB6 CD11C
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden cardiac death diagnosis Wound age identification

MANE select

Transcript ID
NM_000887.5
Sequence length
4663.0 nt
GC content
0.5634

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1811.50 kcal/mol
Thermodynamic ensemble
Free energy: -1894.67 kcal/mol
Frequency: 0.0000
Diversity: 1118.67
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......(((.(((...(((((((.(((((((((((........)))))....)))))).......((((......)))).))))))).((((((((..........(((((((.(((((.........(((((((....)))))))(((.((((.(((...))))))).)))(((((.((((((..........)))))).)))))....((((.((....))))))(((((((((................))).))))))...((((.(((....((((((((.......))))))))(((((((.(((....))).))))))))))))))))))).))))))))).))))))..((((((((((.((...(((.((((........)))).))).((((((((.(((((.(..(((.((((.(((((((........)))).))).))))(((((((((((((((.((....((((........))))...)).))))))).))))(.(((...((((((((((........)))))))).))...))).).))))....((((((((....((..(((((((((.((..(..((((.(((.........(((((((.(((((.(((((((..(((....((((((((.((((((................((((((((((..(((((...(((.(((.((((.((((((...((((..((.(((....))).))..))))...))))))........((...))((((((...((((((((((.(((((((......(((((....))))).....((((((((.......((((((((((....)).)))))))).......)))((((.(((........))).)))))))))((((((((((((.....))))))...))))))))))))).))........((((((((...........))))))))......))))))))(((((((((.((((((.................).))))).)))))))))..((((.....))))...((((.((((((((.......((((..(((..(((......))).)))))))...))))))))..)))).))))))...((((((.(((((((((((...........)))))...((((((((((..((((((((((.(((((((..(((((((((((((((((((((((((.....(((((((...........(((((((((......)).))))))))))).)))......(((((((((....))).))))))..)))...)))))))))...(((((.((((.(((.....))).))))...)))))))))))....))))))).)))))))..((((...(((.((((((..((((((((((((((.(((((((..((((((......))))))((((((((.(((((((..(((((((((((((((((.((..(((((((((((.(((((......................)))))))))))))))))))))).)))).(((..((.((((((..((..((.((((((.(..((((((((((....)))))(((((((.((((.(((....))).)))).)))))))(((((..((((((((((.((..(((...((((...(((.((((((...(((((((((.(.(((((.(((....(((((((((((.((.((..(((.((.((...((((..((((.((((...(((((.((.(((((((......(((((((((.(((.(((.((((((.(((((((((((((((..(((((.((((((((.........((.((((((..(((.(((((.(((.((.((((.(.((((((((((((((((((((((.((((((((((...(((.((((((.((((((.....)))))).)))))).)))....)))))))).))))))))...))))))....((((.(.(((((((...(((......)))...)))))................((((...))))..((((.((((.......)))).)))))).).))))....)))))))))).).)))).)).))).).)))))))..)))...))).))............(((.((......)).)))(((((((((((.(((((..............))))).)))((.(((....))).))...))))))))..))))))))..((((..((((.........)))).))))((((((......)))))))))))...)))((((((......))))))....))))).)))))))...))))))...........))).))).))).)))))).........((((.(((...))).))))....(((((((((...)))).)))))...))))))))))))))....)))).)))).((((((..(((((((((.(...((..((((....))))..))...))))))))))(((((.((((...((((((...))))...))...)))).)))))(((.........)))..)))))))))).)).))))))).)))))))))))))(((((((..(((((...)))))..).))))))..............))).)))))).))).))).))).))))))..))).)))).))))).)))..)))))))..)))))((((((((....(((((((...(((.....))))))))))..........))))))))..)))))).))))))..))..))...))))))))..)))...))))))))).((((.....)))))))))................(((...((((((((...)))))))).)))...(((....)))............((((((.....))))))))))))))))..(((......)))......))))))).)))))))(((.(((((.(.((((.....((((((.(.(((.(((.....))).))).)..))))))....(((((...............))))).((((((...(((.(((.(((((..((((....))))...))))))))..).))...))))))..)))).)))))).)))((((.((((.(((((((........)))))))..)))).)))).((((.((....)))))))))))))(((.....)))..((((..((((((.((.(((((..(((((.(((((((((......)))).......(.((((.((((((((.(((((((((((((((.....((((((((.........(((.(..((((((((.((((((...........(....(((((.((.(((........(((((((((((((((((((..........)))))))).(((.....(((.((((((((...(((((...........))))))))))))).)))..)))......(((.......)))..)))))))))))))).))...)))))....)...........)))))).))))))))..).))).)))))))).............((((.(((((((....))))))))))).......((.(((((.((.....)).)).))))).)))))))))))..((((((((...(.((.(((((((.(((((((((.((((((....((((((....)).))))..)))))))))))))))((.((..(((.....)))....))..)).((((((....))))))....((......)))))))))...)).)....)))))))).(((((..(((.((....)).))).......................................((((((((((....(((.((..((((((((.((((((((.((((.........)).)).))))..))))))))...)))).)))))....)).)))))))))))))))).).)))))))).)))).).....)))))))))))))))))..)).))))..))))((((.........)))).)))))))))))))........))))))))))..))))))))))...).))))))))))))))).))).)))((((((((((((.......))))).))))))).(((((((.(((.......))).))))))).......))))).....)))))...)))))......(((....))).)))))).))))).)))(((((((.(((((((((........))))))))).))))).)))))..))))))))))))...)))))))))).))))..)..)).))))).)))).))..))))))))..(((((....)))))...)))..)))))).))))))))........)).))))))))))...(((((..........((((((((.(((((((....))))..))).))))))))(((((((..((((((((((((.....((((..((((...((((((....))))))))))..))))..))))))))).)))....).)))))).............))))).................))).)))
Thermodynamic Ensemble Prediction
.......(((.(((..((((((((({((((((((((........})))},...}))))).....{{((((......)))).}}...))))}}}}|..,.........(((((((.(((((.,.......{((((((....))))))|(((.((((.(((...})))))).)))|((((.((((((..........)))))).))))}.,.,|{{..{,..,{|,|||{((((({{((..............,,))),)))})),..((((.(((....(((((((({....},})))))))(((((({.(((....))).})))))))))))))))))).))))))}||{||||||{|{((,{.,{((.{....{{{.((((........)}}).))).((((((((.(((((.(..(({.((((.(((((((........)))).))).)))){{(((((((((((((.({....(((({.....}})}))...)).))))))).))))|.(((...((((((((((.{....,.)))))))).))...))).,.}},},}..((((((((....({..(((((((((.((..(..((((.(((.........(((((((.(((({{(((((((..(((....((((((((.((((((..............,{(({{((((((..(((((...(((.(((.((((.((((((...((((,{(,{(((....)))}),}}))))...))))))........(({....|||{{{...{(((((((,..{{{{{({{,{{,.(((((....))))){{,,.(((({(((..,....((((((((({....,,.)))))))).......)))((((.(((........))).))))})))){||{({((((((.....))))))...}|}}})}}}}}))|}|||{|..,.{{{((({,....,,,,,|,|}}}})))}}},..)))))))}(((((((((.((((({..,,,.......,,...}.))))).)))))))))..{(({.....}))}...{{{{.{(((((((.....{,((((..{((..(((......})).))}))))..,))))))))..}}}}.|}}}}}.,,((,(((((((((.(.(((....})}}}))).)))}}.((((((((((..((((((((((.(((((((..(((((((((((((((((((((((((...,.(((((((...........(((((({((......)},))))))))))).))).,....(((((((((....))).))))))..}))...)))))))}}.,{(((((.,((({(,,.,}}}),.,))))}..,,}))))))))....))))))).)))))))..{(((,,.(((.((((((.((({{,,{{(((((({{{{((((..((((((......)))))),{{{||||}|||||(({{(({{((((((((,(((((((,,(((((((((((.(((((.,.............}.}....)))))))))))))))).||||}{|||}.,,{{{(({((((((..(({.(,{((,((({({,(,{{{{((((,..,|||||(((((((.((((.(((....))}.)))).))))))}{((((..((((((((((.{,.{(((...(((({,.{((.((((((...((((((((({({(({(({(,{....(((((((((((.((.(((..{{.((.((...((((..((((.((((...(((((.({,(((((((...,..(((((((((.(((.(((.((((((.(((((((((((((,(,.{{{{|,(((((((((({(((({{,({({,(((.,{((.(((((.(((.((.((((.,.((((((((((((((((((((({{((((((((((.(.(((.((((((.{(((((.....)))))}.)))))).)))....)))))))).)))))))}..,))))))|{({{(((.,{({(((({...(((......)))...))))),....,,..,,}..,,{{(({{{|,||..{|||,||{{......,)))).|}}},,.,.},,}}})})))))))))}.).)))).)).))).).)))))))..)))||,,,,.)).......,..,((((.((......)).)))).|}}((((((.....(((({,...(((,...})))...))|)|}}))))))},),)},))))..))).))))))))..{(((..((((..{,...,})))).)))|((((((......))))))}}}}}...,|.((((((......)))))).,.})))))))))))))...))))))...........))).))).))).))))))..,......((((.(({...})).))))....(((((((({...})))}}))))...))))))))))))))....)))).)))).,,{,(({{(((((((((.(...({..((((....}))),.))...))))))))))|||||.{{,,..,(((({,{{{||||...}}...}|||,,}}}}|||,......,}))),})))))})))).)}.))))))).)))))))))))))(((((((..(((((...)))))..).)))))).............}))).)))))).))).))).))).))))))..)})})))).))))}.))),.)))))))..))))|((((((((...,(((((({,..{(|||,..}}}},))}))..,.,,....)))))))),{||||,,,|,,,,}.}),.}))}}.}||||}|||||||,.,||||}||||..,||||{,.}})))}}}|.....}}},},.....(((...((((((((...)))))))).)))...{{{.,{{|}}....||||,...((((((.....))))))|||||}|}},..{{{,,,,,.|||,,....}}}}))),))))))}|||,{,{{{.(|((((,{.{.((((((.{.(((.(((.....))).))).,..)))))),..}|||||}}}},,}}}}..,}}))))).|||{|{},,,||}|||}||{||,,||{|,,,.}},}...}}}}||||..,.}),,.}))))).}))})})}))}},)))||{|,|||{.{((((((,,.,,,,,|}}}}}},,)))).}}}).||||||||,..||}||||,,,,)))||},..}}||{{((((.,((((((,((.(((((,,(((((.((((({(({......}))}......,(.((((.((((((((.{{(((((((((((({....{({((((((.,{{{,....(({(,,(({{{{{|.{,{(((................{{{{|}|}.{|{,||},,,,(((((((((((((((((((..........)))))))).(({.{,..,({,{(((((((...(((((...........))))))))))))),},},.})}....,,(({.......))).,)))))))))))||{,|||{,|}}}}....,.....,|{{{{||}}||{,}}}}}}},,,...}.||||..,,.............((((.(((((((....))))))))))).......||,||,,,,|||},}}))})).))))).}))))))))))|,((((((((...{.((.(((((((.((((((({{{((((((....((((((....)))),)).,))))))))))))))){{.{{{{(({.....))},..,,}..}}.((((((....))))))....||......},)))))))...)).}....)))))))).|||||,.(({.{{....)).}}).,,,,..................................,{{((((((({...|||}||}}((((((((.((((((((.((((.,,....},)).)).))))..))))))))...)))).}}}}}....})}}}}))))))))))))).).)))))))).))))}).....))))))))))})))))),,)))))))..,,,,,,,|}}}},,,,,)))}.)))))))))}})),,,.....))))))))))..))))))))))...,,))},,}))))))))).))).)))((((((((((((.......))))).))))))).(((((((.(((.......))).))))))).......))))).....)))))}..,))))...,..(((....))).)))))).))))).)))(((((((.(((((((((........))))))))).))))).)))))..))))))))))))...)))))))))).))))..)..)).))))).)))).)}..)))))))).,(((((....))))).}.})),,)))))).))))))))..,,..})),}))))))))||{{{,|.......,.}}}}|(((((((.(((((((....}))),.))).)))))))},,,,(({,{(,{,,,{({{{{,,..,((((.,{{{...{{({(((,{,.,....,,,,,,,},))},,,)}}}}))},,....,)}),))))}},,,,,})).{((({,{...........,)))))))).)))

Transcripts

ID Sequence Length GC content
ACUUGCUUCCUCAGUACCUUGGUCCAGCUCUUCCUGCAACGGCCCAGGA… 4663 nt 0.5634
ACUUGCUUCCUCAGUACCUUGGUCCAGCUCUUCCUGCAACGGCCCAGGA… 4092 nt 0.5701
Summary

This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]

Forensic Context

A study in humans demonstrated that the ITGAX (ITGAX) is down-regulated in sepsis non-survivors compared to survivors, is significantly correlated with monocytes, and functions as a receptor in the CD23 and ICAM pathways [Liu et al. DOI:10.1590/1414-431X2025e14930]. A study in mice identified the ITGAX (Itgax) as a hub gene with downregulated expression in acute myocardial infarction (AMI) and linked it to cardiovascular disease progression [Wu et al. DOI:10.1016/j.ygeno.2023.110701]. A study in human skin wounds identified CD11c as a proteomic marker for dendritic cells (DCs) used in wound age estimation [Ros et al. DOI:10.3389/fmed.2021.786798].