Basic Information

Symbol
ITGB2
RNA class
mRNA
Alias
Integrin Subunit Beta 2 LFA-1 MAC-1 CD18 MFI7 Integrin, Beta 2 (Complement Component 3 Receptor 3 And 4 Subunit) Complement Component 3 Receptor 3 And 4 Subunit Integrin Beta-2 Integrin, Beta 2 (Antigen CD18 (P95), Lymphocyte Function-Associated Antigen 1; Macrophage Antigen 1 (Mac-1) Beta Subunit) Cell Surface Adhesion Glycoprotein (LFA-1/CR3/P150,959 Beta Subunit Precursor) Cell Surface Adhesion Glycoproteins LFA-1/CR3/P150,95 Subunit Beta Leukocyte-Associated Antigens CD18/11A, CD18/11B, CD18/11C Leukocyte Cell Adhesion Molecule CD18 Complement Receptor C3 Beta-Subunit Complement Receptor C3 Subunit Beta Integrin Beta Chain, Beta 2 CD18 Antigen LCAMB MF17 LAD
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Cause of death analysis

MANE select

Transcript ID
NM_000211.5
Sequence length
2807.0 nt
GC content
0.5946

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1127.20 kcal/mol
Thermodynamic ensemble
Free energy: -1174.36 kcal/mol
Frequency: 0.0000
Diversity: 891.58
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((..((((..((((.(((.(((....(((((((((((..(((((((((((...((((((....((((.((((((((......((((....((((((((..........))).))))).))))))))))))))))))))))..(((((((.((.....(((((..(((..(((((((((((..((((.(((((((((((((((((((((...))))..((((.....))))....)))))))...))))))))).....).))))...))))))(((((((.((....)).))))))).)))))..)))....))))).......))))).))))......(((((..(((..(((((((.((......)))))))))........((((((((.(((((......).)))).)).))))))....)))..)))))(((.(((((..((((...(((((..(((((.((.(((((.(..((((((((.......((((..((((.........))))..)))).((((((((((((((((..(((.(((...))).((((.(((..((((.((((.((..((..((((.....))))..)))))))).)))))))))))...((((..((....)).))))....((.((......)).)).......((.(((((((((.(((((.((((((......(((((((((...............))))))))).((((((((((.......))))))).)))...)))))).)))...)).)).))))))))))))..)).))))))))))))))((((((((((...((((.(.(((........))).).))))(((((((((((.((((........))))....(((.((.(((.(((((((.((..(((((..(((((..(((((...)))))...))).)).......(((((.(((((((.........((((((.(((.(((((((((((((((......)))))))).............))))))).((.(((((((..(((((..........)))))..)....)))))).)).......(((....((((((((((((((......)).))))......(((((((.((((..((((....)))).............((((((.....))))))......(((.((((..((..((((.......((..((((((.((((((..(((.(((.(((((.(((((..(((........)))..)))))..(((((........)))))....((((((...))))))..)))))..))).....)))...)))))).))))))..))..(((.(((((((((((((((((....((.((((.....))))))...)).))).)))).)))))))).)))(((..((((((........))))))..)))..))))..))..)))).)))((((..((.(((((.(((((.((((((((......)).)))).((.((((((((((..((....(((((..((((..((.(((.(.((((....)).)).)...))).))....))))..)))))..)).))))))))).).))(.((((((((......((((...(((...)))..))))...)))))))).)...)).))))).)))))....((..(((((.((.(((.((((.(((..(((((((((((.(((((........))))).))).....)))))))).)))..))))))))).)))))..))))..)))))))))))))))(.(((....))).).))))))))...))).)))..))))))((((((((((((((..........))).))))).....))))))..))).))))))))))))))..))))))))).))).)).))).)))))))))))...))))(((((..((((.((.(((((..(((((...))))).....))))).)))))))))))..)))))).((((((((((..((......))....)))))...)))))))))))))..))))))))(((.(.(.(((.....))).).).))).)))))....)))))...(((..(((((((....))))))))))(((((((.(((((((((((......(((((((........((((((.(((((..((....(((((((((((((......))))))))..(((((..((((.(......).))))....))))).))))).(((((((((((((((.((...(((..(((....)))....)))...)).))))))).)))))))).((..(((((((.((...(((((((((.((((...)))).)).)))))).)....)).))))))).)).))..)))))..)))))).....)))).))).....)))))))))))))))))).((((.((............)).)))).((((((((........)))))))))))).))))).))).)))))))))))))))..)).)))))....)))))).)))).))))))).))))((.((((((((((((((((((.((.((((((...........)))))).).).))))))...)))))).((.(((((.(((......))))))))))....................(((((..........)))))....((((((......))))))....(((.(((((.(((............))).))))).).)))))))).)).
Thermodynamic Ensemble Prediction
,{{{,{{..((((,,((({.(((.{((....((((({{({((..(((((((((((,,,((((((....((((.((((((((...{,.((((....||||((((,,{.......})),))))).)),,))))))))))))))))))..,((((((.((,,{..{{{{{.,(((,{(((((((((((..((((.(((((((((((((((((,{,(,,{||,},,({{{.....))})...,)))))))...))))))))}...,}).))))...)))))){{{{|||,|{....}},))))))},|}))).,}}}.,,.}}}}),.|,|.,|||||.|||}...,{,(((((,,{{{..((((((,{((......))))))))}......{{{(((((,,.(((((......},,))).,}.))))),,,.}))},,}}}||(((.(((((..((((...(((((..(((({.{{.(((((.(..((((((((.......((((..((((.........))))..)))).{(((({(((({{(((,{{(((,{...,,|||.{({(((({..((((.({{,,||,,||,,{{{{..,,,||||,.|,||||||,||}||||}}}}...((((..{{....}).))))....,,.,,.,{,...,.)).,.....{{.{{{((((((.(((({,((((((,,{...(((((((((...............))))))))).{{(,{{((((,...,,.|||}}}|||||...}))))).}}}.,,)},||,||||}||,}|||..},.})))))))))))))||||{{{||,.,,{|||,(,(({...,,,..))),).)))}||||{{{((((,{{|{.,{({.,{|,,,||,.(((.((.(((.{((((((,((,.(((((.,({(((..(((((...)))))...))).)).......((((,,(((((((..,,....,|,((((,....|||||((((((((({......)))))))}...........,,))}}}}},{(,(((((({..{{{((.{,,,.....}}}}}..}....)))))).}},,,|,|.{{,,.,.{{|{|||||(((((......}}.}}}),.....(((((((.((((..{{{{....)))}.............(((((({...})))))).....,{((.,(((({,,..((((({.,(((......}|||,({{{{({(({..{{{,{({{{.(((((..(((........)))..))))).,{{|{|,|,{{{{..,,,,..}}||,((({{{||,|,,..|||||{.{|.{{{({{(({{{{{{{{|.|{||.|{{|{{,(((.(((((((({((((((((....{{.((((.....)))))}..,|,.|})}))),,)))))))).))}{{...((((((.,....,.))))))..}))))}))))}))}}))},})))}}.)))),.)|)}))}),(({(({,{,{{,{|.....(((({..,.,,,,,|||||..}}.},,,||||}},|,|}}||}||..|}||||,,,,)).,,.,..,}}}.},..,.}}))}})),)}})))},,||}}|||{|,{{{{(({{((({,,....((((..,({{..,)}}..))))...,,}))))},},}))).,))}}}}}}},....,{..(((((.((.(((.((((.(((..(((((((((((.(((((.,....,.))))).)))}....}))))))).})),,))))))))).))))),,))||,.}})}))))))))))),.{{|,...))}.|.}})))))),,|})).}||,,||||||(((((({(((|((({{{|.....}))},))),),},,.))))))..))),))))))))})))))|,)}}}})))}.})).)).))).))))))}}},}..,}}}||{||||.|||||||,||{{{,,|,{||,,,|}}}},}}..))))},)))))))))}),})))))),||{|||,|||,..,...,{{.....}))|||...)))),))))))))..)))))),}((({({{|(((.....)}),)}}.)))}))))).}}})))))...(({..(((((((....)))))))}))(((((((.(((((((((((......(((((((....{,..((((((.(((((..((....(((((((((((((......)))))))).,(((((..((((.{......,.))))....))))),})))).(((((((((((((((.((...(((.,(((....))).,..)))...)).)))))))))))))))).,{..(((((((.((...{(((((({(.((({...}))).)).)))))).)....)).))))))).}).))..)))))..))))))...,,))))},)).....)))))))))))))))))).((((.((............)).)))).((((((((........)))))))))))).))))).)))}))))))))))))))}..}}.)))))....)))))).)))).)))))}),)}}|((.{{{{|||||{{{,{{{|{||{,{|{||{,.||.,,,},,)))))).),).)))))),..}}}}|},{({(..,,}|}|||||,,.||}||||}|,.,{{{,..,{,........|}|.,|||.,},,,.}}.}),}}),|||||,..,,,|,,,,,,.....(.(((((.(((............))).))))).),)))))})),},.

Transcripts

ID Sequence Length GC content
AGACGUGACCCAGGGCAGACUGGUAGCAAAGCCCCCACGCCCAGCCAGG… 2807 nt 0.5946
ACACUUUUCUUGGAGACACAUCCCCAAAGAAGUCCUCACGUGGCUCCGU… 2890 nt 0.5858
AGACGUGACCCAGGGCAGACUGGUAGCAAAGCCCCCACGCCCAGCCAGG… 2850 nt 0.5968
Summary

This gene encodes an integrin beta chain, which combines with multiple different alpha chains to form different integrin heterodimers. Integrins are integral cell-surface proteins that participate in cell adhesion as well as cell-surface mediated signalling. The encoded protein plays an important role in immune response and defects in this gene cause leukocyte adhesion deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

Forensic Context

A study in mice demonstrated that the ITGB2 was identified as a top hub gene with the highest degree in a protein-protein interaction network and its expression was downregulated in infarcted left ventricular tissues following acute myocardial infarction [Wu et al. DOI:10.1016/j.ygeno.2023.110701]. In human studies, quantitative real-time PCR validation on peripheral blood samples confirmed that the ITGB2 expression increased sharply in patients with post-myocardial infarction heart failure compared to non-heart failure patients, and it was incorporated into a 13-gene predictive signature that achieved high diagnostic accuracy [Sun et al. DOI:10.3389/fimmu.2023.1163350]. A study in porcine skin exposed to bromine vapor demonstrated that the ITGB2 (CD18 leukocyte adhesion molecule) was significantly upregulated, showing an approximate 2.9-fold increase in both 10- and 20-minute exposure groups at 48 hours postexposure [Rogers et al. DOI:10.1002/jbt.20383]. This transcriptional change was part of a broader inflammatory response identified through microarray analysis and pathway mapping, where the ITGB2 was characterized as a signaling pathway component among 30 genes commonly shared across 19 significantly altered canonical pathways.