| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACGUGACCCAGGGCAGACUGGUAGCAAAGCCCCCACGCCCAGCCAGG… | 2807 nt | 0.5946 | |
| ACACUUUUCUUGGAGACACAUCCCCAAAGAAGUCCUCACGUGGCUCCGU… | 2890 nt | 0.5858 | |
| AGACGUGACCCAGGGCAGACUGGUAGCAAAGCCCCCACGCCCAGCCAGG… | 2850 nt | 0.5968 |
This gene encodes an integrin beta chain, which combines with multiple different alpha chains to form different integrin heterodimers. Integrins are integral cell-surface proteins that participate in cell adhesion as well as cell-surface mediated signalling. The encoded protein plays an important role in immune response and defects in this gene cause leukocyte adhesion deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
A study in mice demonstrated that the ITGB2 was identified as a top hub gene with the highest degree in a protein-protein interaction network and its expression was downregulated in infarcted left ventricular tissues following acute myocardial infarction [Wu et al. DOI:10.1016/j.ygeno.2023.110701]. In human studies, quantitative real-time PCR validation on peripheral blood samples confirmed that the ITGB2 expression increased sharply in patients with post-myocardial infarction heart failure compared to non-heart failure patients, and it was incorporated into a 13-gene predictive signature that achieved high diagnostic accuracy [Sun et al. DOI:10.3389/fimmu.2023.1163350]. A study in porcine skin exposed to bromine vapor demonstrated that the ITGB2 (CD18 leukocyte adhesion molecule) was significantly upregulated, showing an approximate 2.9-fold increase in both 10- and 20-minute exposure groups at 48 hours postexposure [Rogers et al. DOI:10.1002/jbt.20383]. This transcriptional change was part of a broader inflammatory response identified through microarray analysis and pathway mapping, where the ITGB2 was characterized as a signaling pathway component among 30 genes commonly shared across 19 significantly altered canonical pathways.