Basic Information

Symbol
ITGB3
RNA class
mRNA
Alias
Integrin Subunit Beta 3 GPIIIa CD61 GP3A Integrin, Beta 3 (Platelet Glycoprotein IIIa, Antigen CD61) Platelet Membrane Glycoprotein IIIa Integrin Beta-3 Antigen CD61 Integrin Beta Chain, Beta 3 Platelet Glycoprotein IIIa Integrin Beta 3 CD61 Antigen BDPLT16 BDPLT24 BDPLT2 FMAIT1 GT2 GT
Location (GRCh38)
Forensic tag(s)
Sudden death from CNS diseases Other applications

MANE select

Transcript ID
NM_000212.3
Sequence length
5941.0 nt
GC content
0.4974

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2093.30 kcal/mol
Thermodynamic ensemble
Free energy: -2202.94 kcal/mol
Frequency: 0.0000
Diversity: 1501.00
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(.(((((((((((....))))((((((((((....((((.(((((.((((((.(((((((.(((..(.((....)).).)))))))))).))).)))..))))).))))(((((((((...((((.((((((.((((.(((.(.(((((.(((((......))))).).)))).)))).).))).))))))...)))).)))))).)))..((((((((.((((((.((.((((.(((...((((....((.....))......)))).))).)).)).)).)))))))))).))))((((..((.(((.(((.((((.((((..((..(((((((((....((((((((((((.((.(((((((((.....)))))).)))..(((....)))(((((.((((.((...(((((((((...........))))))))).....)).)))))))))....(((.(((((..........))))).)))))))))))).))))).)))))).(((((((((......((((((((((.(((............)))..))).))..)))))(((..((((((((((((..(((((((((....................(((.((((((.((((.....(((((((..........((((((((((((((.(.((((((....)))))).).))...((((.........))))...((((((......))))))...)))))).))).))).((....))....((((....))))(((......))).((((((((((....)))))).)))).......(((((.(((......(((.......)))(((((((.......)))))))...........((((((((.((((((((((((.....)).))))))).....((((.((.(((((((((((((((...................)))))))).(((((.((((..(((((((((..(.....)..)))...))))))....(((((.((((((........((((((......))))))......))))))...((((((((((.......(((((....((((((((((.......))))))))))...)))))..))))))))))))))).....)))).)))))((((((...)))))).......))))))))).)))).((((....)))).)))))))))))((((((((((((...((((((((.((.((..(((.(((((((.........))))))).))).)).))))).)))))...)))))))..)))))((.(((((.(((..((.((((((....)))))).))......((((.(((((.(((((....)))..((((((.((((((........))))))......(((((((((.............((((....))))..(((((((((.....(((((.......))))).))))))))))))))))))..(((((((.....(((..(((.(((....))).)))..)))...))))))).)))))).)).))))).)))).))).)))))))))).)))))))))))))))).)))))))))(((((.((..((((....))))..)).)))))..)).)))))))..)).))))))))))..)))(((((((((((.....))).))))))))..))))))))).....)))..))..)))).)))).)))))).))..))))..((.(((((((((.((((....(((...((.((.((.(((.(((..(((.(((((....)))))))).))))))..)))).))..)))......)))).))))).)))))).(((((((((((.....(((((.(((.........))))))))...))))..((((((((((.(((......))).)))))).))))((((((((((((((((((....(((.((((((......((.((((((((((....)))))).).)))))..((.((((((((((..((((((((((..((.(((((((.(((((.(((((((((.(((((((((((((...((((...((((.((..((....))..)).))))((((((..((.((((((((((...((((.((((((.....((((((((........)).))))))(((((((....)))))))))))))))))..(((((((....((((((((...(((....((((((..............((((.....)))).......))))))........))))))))....)))..((((...........)))).....)))))))................)))))))))).)))).))))..))))..)))))))))))))..)).))))....(((((.((.(((.(((((....))))).))).))..))))))))))))).....((((((((...(((((((..((((((((.(((((.(((((..((((.((((.(....((.((((((((((((.(((((((((((((((((((.(((((((.(((.(((((..(((((((.(((((.((((.......(.((((.((.(((....((((((...)))))).....................(((((((...)))))))...(((((((((((((..(((((((((((.(((((((((.....(((((((......((.(((((.(((.(((((........))))).))).))))).)))))))))(((((......))))).)))))))))..).)))))))))).((((((.(((((....)))))..)))))).((.(((((((((((....(((((((....(((((((....)))))))....))).))))....((((((((..(((.....)))..)))))))).((((((((((((((((((((...(((((...((...................)).))))))))))))....((((((.....)))))).))))..)))))))))))))))))))).))(((.((((((...)))))).)))....((((.(((((((((((....))))))))))).))))....((((.((((((((.(((((.....)))))......)))))))).)))).............)))))))))))))))).)))))).)..........)))).))))).))))).))....))))).))))))))))((((((.(((......)))..........)))))).(((((.((((.(((..(((((.(((((....))))).))))).....))))).)).)))))....))))).)))))))))))).....((((((((((....((((((.(((((((.(((.(((((..((....))..))....(((((((((.((((((..((((...)))))))))).)))))))))...))).)))))))))).(((((.(.....).)))))((((.((((((((........(((((((....)))).))).....(((((........)))))))))))))))))......((((((((........)))))))).(((((.......)))))(((((......))))).(((((.......))))).........))))))......))).)))))))..)))))))))))))).)).).)))).)))))))))))))).).....((((((..(((((((....)))))))....))))))((((((.(((((...((((((((..(((((...((((((....))))))....((((.(((.(((.((((((....)))))).)))))).))))..((((((...(((((((((.........))))))))).)))))))))))...))).(((((...(((((((((((.((....(((((((...)))))))...(((..((.(((....))).))..)))...................)).)))))..)))))).))))).((((((.....))))))((((((((((((((.......((((((((((..(((((((((.(((((((((.(((((((((..((.......((((((.(((...)))))))))..))..))).)))))).)))))))))...............)))))))))..)))).)))))).(((((........))))).))).)))))..))))))(((((.....)))))((((((.((((((...(((((((((((((....)))....((((((((......))))))))............((((((((((......((((((....((((......))))(((.(......)))).))))))......))))))))))((((((((((((..(((((.(..........).)))))....))))).)))))))(((((.........)))))..(((..(((((..(((.((((((...)))))).)))...)))))..)))))).)))).)))...))))))))))))((((((((((..(.((((.(((((..(((((((((((.((((((((((....))))))))))........))))..)))))))..((((((((((....))))))))))(((....)))((((((..((.(((((((.(((.(((...((((((....(((((((((((......((((((((.......)))))...))).......)))))))))))..))))))...........)))))).)).))))).))..)))))).....(((((((((((((((.(((.....(((((((.....((((.((((((..((((((((((((((...((((..((((.......))))))))...)))))..)))))..)))))))))).)))))))))))...(((((((.....))))))).........((((.(.......).))))))))))))))))))))))................((((((((((((............))))))))..))))........))))))))).)..))..))))))))......)))))...)))))...))))))......((((((((...)))...)))))((((((((..(((....)))..)))).)))).............)))))))...))))))))))))))).((((((((......(((....)))......))))))))....................((((((......)).))))(((((((..(((...((.(.((((....)))).).)).)))..))).))))(((((......)))))((((....))))..)))))))))..))))))..(((((.......)))))))))..))).))))))).)))))))).)))))))))))).)))))))))......................((.(((((...))))).)).....))))))).((((((((((.......))).)))))))...)))))))))).((((((((((..........(((........)))((((((((......(((....)))......))))))))...................((.(((.(((((..((((((.((....(((((.(((....)))))))))).))))))..).)))).))).)).(((((......))))).....)))))))))).))))))))....(((((((.........(((((.......)))))..)))))))....(((.((((((...(((((.............)))))..)))))).))).
Thermodynamic Ensemble Prediction
((((((.((((((((.(((((((((((...(((((((((.(((((.((((((.(((((({{(((..,{((....,)})})))))))))).))).)))..))))).)))),(,((((((...((((.((((((.((((.(((.(.(((((.(((((......))))).).)))),}))).).))).))))))...)))).)))))).)||{.((((((({{((((((.(({,(((.(((...((((....{(.....))...,..)))).))).))},),)).))))))))))},))))}}.((((((((((((((((,,,........))))((((((....((((((((((((.((.(((((((((.....)))))).)))..(((....)))(((((.((((.((...(((((((((,..,....},.))))))))).....)).)))))))))....(((.(((((..........))))).)))))))))))).))))).))))))..((((((.(({...}))..))))))...(({{{((({.,({(,...})),})...)))))))(((((((((.((.....(({((((..((((((((.((,...((((({{{((((.((((((.....{({,{{...({{{(,..((((((.,((((((((.(({{(((((.((...(((.((((((......,,,{{{|||{...((((((......))))))..{{.((((((((((((((...(((((.{{((((....}}||(((......)))|((((((((((....)))))).}}}}....,,,(((((({,{,|{{.,,},,,,..{((((((((.(({.,,.(((((((.............)))))))..,))).)))))))))}}}},}))))))..,{{{{|,,,..)))))).))))).)))))).....)))))))).}},,.}}}}.))).,,..,((((((.(((((((.{{{,,({((.{,..{,.{{{.....,,{({...||||.,}},..,|(((({......)))))}.}}}}..))}(((..((((.((((((....{(((((.{{{.((((((((((.......))))))))))...{{,{((((((((,,,...,,{{{{,{{(({,...,}}})}},.,)))})))))))},).))))}...))))))..))))..}).))))..)))...({{(((((((((((...((((((((,((.((..(((.{((((((.........))))))}.))).)).))))),)))))...)))))))..)))))),(((((((((...((.((((((....)))))).))...(((((....)))))...)))))))))..((((((.((((((........))))))..,,{.(((((((((..,,.........{{((....)))}..(((((((((.,...{((({.......)))}).)))))))))))))))))).)|((((((.....(((..(((.(((....))).)))..)))...))))))}.))))))...))))))).)))))))))))).))).)).))))))))))))))))).....))))))..,|||||{||((,,({{{,.,||,}|}|..|,.,,}.,|}|}}}}}))),{|||.{(({,({{(((({|||,,...}}},,))))))),}))}}||.{((((((((((((({.(((((((({{.((((.(((.({.(((....)))..,((..,..,.}}..(((((((.((((({((((((,..(((.(((((....)))))))).}||||{{.(({((|,{,....}}..}))))).))))}|{{({{{(((,((({{(((((,.(((((.(((.(......,))))))))((((..(((((..(((((({({{,..........,,,)),)))),,}..)))))..))))(({{|{(({.{,,{.......{{{{(({,((((((....)))))).,.|||,|||||||...}.}}}}.,||,{{|}|||.{((.{(({|....,}}}}}}},,,,({.(((((((((((((,,,(({,..,((((.((..((....))..)).))))|(((,{.,((.(((((((((({{.({(,,{({(((,,,,.{{((((((..,,,,,|||.|||}}}|||{|||,.}}))))))))}}}}}}}}}..((((,,{{,.,{{{{{({,.,{(((...,((((((...........,,.({{,.....,))).......)))))).}......))))))))...,))),)}}.|,,.,,,.....,}}}.....||}|},...}}}.,},,,.....)))))))))).)))).)))}.,))))..)))))))))))))..)).,,,|{{|||{||,||{{..|,||}}|(((((((.((.,{{{{..(((........))}..}))))),))))))))}}})),,...}})),))})))))},,,..})))))))))))...((.((((((((((((.(((((((((((((((((((,(((((((.(((,(((,,{,(((((((,({(((.{{{{.......{.((((.((.{{({{{,((((((...))))))..}}}}}..||,.....,...(((((({...)))))))...(((((((((((((..(((((((((((.(((((((({...,.(((((((((((.(((.(((((.(((.(((((........))))).))).})))).})))),,})|.))))))}...)))),)))))))))..),}))))))))){((((((,,{{{{....}}}||..||||||(((.(((((((((((,,,,(({,(({..{{{{(((..(((((({.{((({..{{{{{|..{{.((((((((..,(((((.{{.....)).))))).|..|))))).)).}|..|||,})),.,})))).)}....}))))..,,,..,.,})}))}}))))}}....((((((,...,)))))).}},,...,},,,,,,))))))))))).))).,.||||||,,}))))))}||{,...,|||,(((((((((((....))))))))))).||,|....((((.((((((((.(((((.....)))))......)))))))).)))).............))))))))))))),)),)))))).}..,,,,,,,,)}}}.))))).),))).)).,,}))))).,|||}}})))((((((,({{...,,,}}}.....,....)))))).(((((.((((.(((..,((((.(((((....))))).))))}.....)))))},).)))))....))))).)))))))))))).....((((((((((((({.((((.{(((((({,{{({(,(((......}}}}}}||..{{(((((((..((({...})))..{((((((((.{......}))))))))).,))))))),)),.,|||}}}}}))}..))))}((((.((((((((,,......,{(((({,...}}}}.}},.....(((((........)))))))))))))))))......,,,..,.....{{,,.,}))))),.{((((.......))))}(((((......))))).(((((((((((..........)))))))}}))},,...))).)))))))..)))))))))))))).))..))))))),,,.}}.)))..))))}).))))))))..}.))))))))},)))))}),.,..}))))).)))),{,....,,|..}}|,.)))))))).)))))))),})))}.)).,((((,({{.|||,|{((((,...}}}}}},))))}}.,,}}..((((((...(((((((((.........))))))))).))))))})})))))))))(((((...(((((((((((..,....(((((((...))))))}...(((..((.(({,...))),)),.}}|,,........,,...,.},)}.))))}.,)))))).)))))....)))))))))))){(((((((((((((((.......((((((((((..(((((((({.(((((((((.(((((({((..,,,{({(((((((({.(({...})))))))),})).,))),)))))).)))))))))...............}))))))))..))))}}))))).{((((........))))}.))).)))))..}))))))}.,,..{{{,{{{.((((((.((((((...(((,{({(((..,....||{{,..((((((((......))))))))..,,,,......{(((((((({,,(((,((((((.,,,((((......)))).{{.......,)))))))))))...}},)}))))))))((((((((((({..((({(,(.....,,...).))))}....})))),,))))))(((((.........))))),,(((..({{{(,.,,,.((({((,,,|}}}}}.,,},.,)))))..)))))).}}},.)))...))))))))))))..||||||.({{({((...((((...(((((((((((.((((((((({....})))))))))........))),..)))))))...(.(((((((((((....(((((((({,....,,,(((((((((.,(,{.(((.,{,,((({(((,.,{{{{,((({(((((({,.{{{||,,||})))}.}}}}))}},||}.||{(((((((((((({{,{{{{{{{{{{({,{,......{(((((((,,,,{{.{((...({(..{{...((((((((((((((,{(((.....,{{{(((,,...((((.((((((..((((((((((((((...((((..((((.....,,))}}))))...)))))..))))),.,))))))))).))))}})))))...(((((((.....))))))).........((((.{.......}.)))))))))))))))))))))).}}..}}}....}}}.||,.||||||||...{{{{{{...||||||||.{||,,....,,..,}}|}|||,.,,,||{{|.,},})},,...........{{{{{|{..{{{||},,,,,,{{{{{{{,.{{|}|,,,}}|,.((((((((..(((....)))..)))).))))...,|{{|,..,|||,.,,,,,|)}},,}}}}},,,,,.((((((((......(((....)))......))))))))....,,,|,,,...,)))}))},}})}}},.,}),}},})}|,|))}}||}}}}|},}}|||}}...}}))))}).,}))..,,,.((((...(((((((((.,.,({{{....)))))))))))))...))))||{{,.,,.|}}},...,.((((((....)))))).....,,,}))))))})),,,,,,,,||{{,,,,,)}})..}))}}})}}}}}}}})){{.(((({...})))).}}((((((((.((((((((((((((.,....,))).)))))),.,))))))))...)))).,,.,|))))}}).}}.))).}.,},...)))))))))))))))))))....))))))))))).},)))}...)}}}}}}.....,{{{.,((({((((,{(((.,(((....))).,)})},|),)).)))))))).)))))...)))))))},,,))}}}}},...,.|{|||}....},)))}|,{{((((.(((...))).)))))},,...........,)))).))))))...............(((.((((((...(((((.............)))))..)))))).))).

Transcripts

ID Sequence Length GC content
GUGGGGCGGGCGGAGCGCCGCGGGAGGCGGACGAGAUGCGAGCGCGGCC… 5941 nt 0.4974
Summary

The ITGB3 protein product is the integrin beta chain beta 3. Integrins are integral cell-surface proteins composed of an alpha chain and a beta chain. A given chain may combine with multiple partners resulting in different integrins. Integrin beta 3 is found along with the alpha IIb chain in platelets. Integrins are known to participate in cell adhesion as well as cell-surface mediated signalling. [provided by RefSeq, Jul 2008]

Forensic Context

A study in rats demonstrated that the ITGB3 was downregulated in fetal cardiac fibroblasts compared with neonatal cardiac fibroblasts, as identified through RNA sequencing analysis [Perreault et al. DOI:10.1152/physiolgenomics.00074.2021]. In a separate rat model of blast-induced traumatic brain injury, the ITGB3 was upregulated in whole brains with increasing blast intensity and time after exposure, correlating with vascular wound healing and integrin pathway activation [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].