Basic Information

Symbol
ITIH2
RNA class
mRNA
Alias
Inter-Alpha-Trypsin Inhibitor Heavy Chain 2 H2P Inter-Alpha-Trypsin Inhibitor Complex Component II Inter-Alpha (Globulin) Inhibitor, H2 Polypeptide Inter-Alpha-Trypsin Inhibitor Heavy Chain H2 Serum-Derived Hyaluronan-Associated Protein Inter-Alpha-Inhibitor Heavy Chain 2 ITI Heavy Chain H2 ITI-HC2 SHAP Inter-Alpha (Globulin) Inhibitor H2 IGHEP2
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_002216.3
Sequence length
3146.0 nt
GC content
0.4561

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-924.10 kcal/mol
Thermodynamic ensemble
Free energy: -984.42 kcal/mol
Frequency: 0.0000
Diversity: 748.17
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((....(((((((((((..(((((((..((.........))..))))))).((((((((((..(((((((((........)))))))))...((((....)))).((((..((((((((.(......).)))))))).))))......((((.(((((.....)))))))))..........((((((....((.(((((((.(((((((((((((.(((..((.(((((((...........)))).)))..))..))))))))....((..(((((((((......((....)).....))))..)))))..))........))))))))))))))).)).)))))).)))))))))).(((((..((((((..((........))..))))))..))..)))((((((.(((.(((((((.((((.(((((((............)))))))....((((...((.....))...)))).)))).)))))))..)))((((.....))))....))))))((...(((((((((...((((((((.................))))))))))))))))).))(((((((....(((..(((((......))))).....)))...)))))))...)))))))))))..((((((((((....)))..)))))))((..(((.((((....)))).)))..))(((((((((....(((((..((((.....(((.((((.(((((((((((((....))))...(((((((((.....)))).))))).(((((..((((((....))))))..)))))...(((..........))).........))))))))))))).)))..((((..(..((((((.........(((((.((((((........)))))).))))).........)))))).)..)))).........((((((((((((((...((((((((((..(((..(((..(((((.....((((....).)))..)))))..)))..))).))))).)))))...)))).(((((..((((((...(((((((((((....((((.((...(.((((.((((((.((.......((((.(((((...(((.(((((.(((((((((..(.((((.(((.....)))...)))).)..))))))))).))....))).)))...........(((((.(((((((....)))))..............((((.((((((((...............)).)))).))))))...(((((((...)))))))........(((((..........)))))...((((.(((((......(((((((((...))))).)))))))))))))...........(((((((.(((.....((((((((((.....)))........(((.((.((((((...)))))).))))))))))))......))).))))))).((((((((((..((....(((((.((((........)))))))))....))))))).)))))................)).)))))))))))))))).)))))))))).).))))))....)))..))))))))....))))))..))))).......((((((((.....((.(....))).....))))))))((((((((....((((((.((.........)).))))))((.((((.....((.(((..(((((((((....((((((.((..((((((....((((((...((((..(.(((..(.(((((....))))).)..))).)..).))).........(((....)))))))))..)))..)))...)).)))))))))))))).)..)))))))))))....)))))))).((((..((..((((((...((((((...(((((((.(((((((.((....((((((((((((...((.((((((((.(((((.((((((.((((((...((.(((((((((..(((((...((((((....))))))......))))).))))....)))))))...((((.........))))..)))))).))))..)).)))......((((.(...((((((((((((....((.(((((((.......((((...............(((((((((((.(........).)).)))))))))................((((......))))..(((((((((((((((((((.((............)).)).)))))).(((((((.(((.....((((......(((..(((((((.((......))))))))))))...))))....))))))))))......(((((.((.((((((((((((((.....((((((((((((..((((((((.(..(((((((((((.((...((((.(((.......))).)))).....)).)))))..............))))))..).))))))))..))........(((((....)))))...(((((......))))).)))))))))).))))))....)))))))).)).)))))))))))))))).(((((((...(((.(((......................((((.((((...)).))..))))...((((......))))..(((((....)))))..))))))..))))))).)))))))))))..))....)))))))))).))...).)))).........)))))))))).))....)))(((.(((..(((.....)))))).)))....)))).))))).)).))))))).......(((((((......)))))))..)))))))...)))))).))).)))..))..)))).))))))))))....)))).................((((((...(((((....)))))....)))))))))))....)))))))))......(((((.............))))).((((((.((.(.(((......))).).)).)))))).((((((((((((.....))))))).))))))))))).....(((((...))))).
Thermodynamic Ensemble Prediction
....((((((,...(((((((((((...,,(((({{(({{,{{{{{{||{{|||,||({((((((({,,..,((((((((.,....}.))))))))|{{.((((....)))).)}|...((((((((,(....,,},)))))))).})))}}}}}}}..|}|||,,,}}}}),))))}}...........{(((((,...,..,((((((.(((((((((((((.{((..((.(((((((...........)))).)))..}}..))}))))}....((..(((((((((......((....))..,..))))..}))))..)).......})))))))))))))))}))})},.,..}}}},,,,||{((,((..((((((..((........))..))))))..))..,,(((((((,(({.(((((((.(((,,(((((((...........,)))))}},,..,{,,...{{{{{,,,,..})))).)))).))))))),,)}}((((.....))))....)))))))}}}}|{{{{{,,,|{.((((((((.,{..............)))))))))))))))))}))(((((((....(((..(((((......))))).....)))...)))))))...))))))))))).,(((((((,{{....)))},)))}|||((..(((.((((....)))).)))..}}(((((((((....(((((.,({{{.....(((.((((.(((((((((((((....))))...(((((((((.....)))).)))))}(((((..((((({....})))))..))))),..{{{.,,,,,...,}},....,....))))))))))))).)))..((((.,{..((((((.........(((((.((((((.,....,.)))))).)))))......,..)))))).}..)))).........((((((((((((((...((((((((((..{((,.(((..(((((.....{{{{....).}}}..)))))..))),,)}}.))))).)))))...)))),(((((..((((((...(((((((((((.,,.(({((((...(.(((,,((((((.((.......((((.(((((..,(((.(((((.((((((((({.{.((((.{((.....))}...)))).}.,))))))))).}}...,})).)))...........(((((.(((((((....))))}..||.,....,,..((((.((((((((...............)).)))).))))))...(((((({...))))))).,......{((((.,,,...,..}}}},,{{((((.,({{({,....||||||{{,}}})))),.}}}}}}})}}}}}..,.....||||,......,||,....,{{,(((((({{...|,,.........}}}|}}||{{|,.,||||||,{|||{.,,|||||{..{{.|||{||||||,.{{({{{{(((..((....{||||||,{{...,,,}})))))))}}....}))},))}))),)}})))})}}},....})).)))))))))))))))).)))))))))).).)))))).,}.)))..})))))))....))))))..))))).......,{{{{(((,,...,,.,..||}}}...,,)))})))|((((((((....,{((((.((.........)).)))))|{(.((((.....((.(((..(((((((((....((((((.((..((({{{....((((((,{,((,.{{,{((({.,.((,(({...,,,))}.,,,}.})}}).)))}..,,,...{{(....)))))))))..}}}..)))...)).)))))))))))))).)..))))))))))),...)))))))),{(((..{,..{{{{{{...{{||||,..{{{{|||,|,|,(({{{{{{,,({({{((({({{.{((({(({({{,,|,||..||}|||{|{|||,{,||||,|{{|{|{||..(((((.,.((((((....)))))).}....))))).,||,,,..})})))),..|||||||,,,,,.}},},|})))}}}}}}}..,|,|||,,,...((((.{,...(((((((((((....((.(((((((.......((((...............((((((((({,{(..........}}.))))))))).,.,,...........,,,,..,,,.,}})},(((((((((((((((((((.((............)).))}}})))).(((((((.(((.....((((......((,..(((((((.((......))))))))))})...))))....))))))))))......(((((.((.((((((((((((((...,,((((((((((((..((((((((.(..(((((((((((.(({..((((.(((.......))).))))..}..},.))))),............,})))))..).))))))))..))........(((((....}))))...(((((......))))).)))))))))),))))))....)))))))).)).)))))))))))))))).{((((((,..({{.{{{....,..........|,,{,..((((.{(((...)).))..))))...(({{.....,))))..(((((....)))))..})))))..))))))}.)))))))))))..))....))))))))))).}|,|,,}|||.,..}}}|.}},}})})}}}))},,...,,,{,{{,.,||,.,},.}}}})}})))}}.,}}}}}}},,}})),}))},}}||}....(((((((......)))))))..||||||,..,||}}}}.))).)))}})).,}))}.})))))))))...,||||,...}}}},....,,,,((((((.,.(((({....)))))....)))))))))))....))))))))).,,,}}(((((,...........,))))).((((((.,(,(.(((......})).,,)).)))))).{(((((((((((.....))))))).))))))))))).....{{{{,...,}}}}.

Transcripts

ID Sequence Length GC content
CUUCUUUCUUAAAGCGAACUGUACUCCUCUGCUGUUCCUUUGAACUUGG… 3146 nt 0.4561
Summary

The inter-alpha-trypsin inhibitors (ITI) are a family of structurally related plasma serine protease inhibitors involved in extracellular matrix stabilization and in prevention of tumor metastasis. The ITI family contains multiple proteins made up of a light chain (see MIM 176870) and a variable number of heavy chains (Salier et al., 1987 [PubMed 2446322]; Himmelfarb et al., 2004 [PubMed 14744536]).[supplied by OMIM, Nov 2009]

Forensic Context

A study in humans using proteomics and RNA sequencing identified the ITIH2 as a potential diagnostic biomarker for sepsis, showing its differential protein expression with no change in corresponding mRNA in patient serum [Wang et al. DOI:10.2147/IDR.S380137]. A separate human study employing Summary data-based Mendelian randomization analysis identified the ITIH2 as having expression levels pleiotropically associated with sepsis [Yang et al. DOI:10.1111/jcmm.18559].