Basic Information

Symbol
ITPR3
RNA class
mRNA
Alias
Inositol 1,4,5-Trisphosphate Receptor Type 3 IP3R3 Inositol 1,4,5-Trisphosphate-Gated Calcium Channel ITPR3 Inositol 1,4,5-Triphosphate Receptor, Type 3 Type 3 InsP3 Receptor InsP3R3 IP3R-3 Inositol 1,4,5-Trisphosphate Receptor, Type 3 Type 3 Inositol 1,4,5-Trisphosphate Receptor IP3 Receptor Isoform 3 IP3 Receptor IMD132 IMD133 CMT1J IP3R
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_002224.4
Sequence length
9079.0 nt
GC content
0.5854

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3629.50 kcal/mol
Thermodynamic ensemble
Free energy: -3784.94 kcal/mol
Frequency: 0.0000
Diversity: 2440.16
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((.((((((((((.(((.(((((((.(.((((.(((..(((.((((((((((.((((((((((.(((......))).)).))......(((((...)))))...(((.((((((.....))))))..))))))))).)))))))))).)))..))).)))))((..((((....(((((((..........)))))))))))..))...(((((.(.......((((((((..(((((....)))))....((((((.(((((((....)))))((((.((((.(((((.............)))))...((((.....(((((((((...((((.(((((((((((((((((((((((((........))))))))).....))))).))))))))))).))))))))))....)))....))))..........)))).)))).....)).)))))).........(((.....))).((((........))))..)))))))).......).)))))......((.(((((....))))).))(((((((...))))))).))))))).))).)))))))..............((.((((..((.(((...(((((((.(((((((.(.((((.((((((.(((((((((((((.((.((.((.....))..))..))))).....(((((((((((....(((((((((((..((((....((.((((((.(.((((...)))).).))))))))))))))))).))))))....)))))))))))((.(..((((...((.((((..((((.((.(..(((((............(((((....(((((((.(((...((((((((.....(((.((((.(...(((((((((((..(((((((...((.(((........((.((((((((.(((.(((((((.((((.(((((((((..(((.(((((..((((((((..((((.((((.(((((((((((((((....))))))).....((((.((((.((...)).)).)).))))....((((((....)))))).......)))))))))))).)).)))))).))))..)))))......((((.(((((((.((.((((((........(((((.((...(((.(((((((........(((((........))))).((((....))))....(((((....((((.((.....)))))).....))))).)))).))).)))....)).)))))....((((((((..(((((.((((((.(((.....))).)((.....)).......))))))))))))))))))..(((.........))).(((.....))).)))))))).))))))).))))..............))).)))))))))))))..((.(((((.((((((((((..(((.....)))...))))).......)))))((((((((.(((((..(((.((((..((((((....))))))..((((((((.....)).)).).))).))))))).)).))))))))))).(((.((((........)))).)))..............((((((.....)))))).(((.((((.(((...))).))).).)))....))))).))......))))))).))).)))))))).))...((((((((((((...(.((....(((((........)))))...)).)..)))))))).)))).((((((.((..((((...(((...(((((.((((((.(.....).))))))....(((((((((....)))))))))..((((((((((..((((((((....((..(((((((((((.....))))))...)))))..)).))))))))...((((((.((...)).)))))).((((.(.((((((...(((.....)))...)))))).).((((((((...((((...(((((..(((.(((((..((((....(((((((........)))))))))))..)))))...))).))))).........))))))))))))....(((((.......(((.(((((....))))).))).....))))).......((((((((....))))))))(((.(((((((....((((.((.....))))))..((((((.((.((((((..((((((.((((..((.((((((((...........)))).)))).))....))))..)))))).))...)))).)).))))))..........((((((.(((...))).)))))))).))))).))))))))))))).)))).............(((((.(((........((((.(((.((((((((.(....)..))))))))...)))))))......)))))))).(((......)))..)))))...))).....))))..)).))))))...((((.....))))))).))...)))))))..)))))).)))))...))))).)))....))).)))))....))).))))))).)))))....(((........))))))))..).)).))))..))))))..))))..).))))))))))))))))))..))))).)))))..(((....))).)).)))))))..))).))..((((..((((..(((........)))....))))...)))).............)))).))....(((((.....)))))..((((((.........))))))....((((((........(((((.(((((((((((((((((((....(((((((((((((((((((.((((((((.((.((((..((((((.(((((((((((.((((((((((((((...((((..((.((((((((((...(((....))).((((...)))).((((.((.((((..((((((((((...(((....))).))).))))).))..)))).)).)))).)))))))))).))..)))))))))))).)))))).......((.((.(((((((......))))))).)).)).)))))))..))))...))))))))))..)).))))....((((((((.((.(((((.......(((((((............))))))))))))))))))))))(((((((...(((((..((((.(.((..(.....)..)).).))))...))))).((......))..(((.(((((((((((((.(((((((((((((((.((((((....((.(((((....((..(((.(((...))).)))..))))))).))....).)))))))))))..........(((((...(((((((((((((.(.((((..........)))).).)).)))))))))))..))))).(.((((((..(((((((((((.(((((.(((.((.((((.....)))))).)))...)))))..)))))))............(((.(((((((((.(((((.....(((.....((((....))))...))).....)))))))))))))).)))))))..)))))).).....((((((((.(((((((......((((...(((((.(((((.((((.(((((((.(((.((.....))...........(((((...))))).((..((((.....((((((((.((((((....((((((.......((((.((((...(.(((((.((...........)).))))).)(((((((((((((((.(((((((((((..((((((((((.(((((...(((..((((((((.((((((((....(((.(((((((((((((......)))).)))(((....((((((.(.(((.(((.....)))((((((((((((((..(((.(((((((.(...((.((...)).))...).))))))))))..))))..((((((.(((.((((((((..(((((((((..(.((.(((((((((..(((((((....((...(((...)))...)).)))).)))..)))))))))(((((((((((.(((..(((((.......((((...(((((((............))))))).)))).....))))).)))...)))).....)))))))((((...(((((((...((((..((.((.(((.(((((.(((((((((..(((((.((.((...(((...(.((((((((....(((((..((((((.((((...((((..(((((((....)))).))).((((((...........(((((((((.(((...(((((((((((..(((((((.....((((......))))....))).))))..(((((((((......((((((((((((((....)))...(((((((((((((..((((.......))))..)))).(((((((..((((......)))).)))))))((((.(((((..(((.(((.....(((..(((....)))..))).....))).)))((((.(((((.((((((((((.(((((((....((((((((((((((......))))(((((((((......(((((((((((...(((...))).)))))).....)))))......)))))))))...........(((((((...(((((........)))))(((((((.(((((((.((((..((((((.((.(.((((.(((((........))).)).)))).))).)))))).....(((((.((((.((((...))))..)))))))))......(((((..(((.((.(((.(((....)))))).)).)))..)))))))))))...))))))))))))((((...))))...((((.........))))....(((((((......)))))))....(((((.........))))).((.(((........)))))...))))))).((((((((......(((((((..(((....))).((((..(((((((((((.((((((((((((.(((...((((..(((((..(((((((((....))))))))).)))))(((((((..((.....((((...(((((((((((.((((.(((((....(((.(..(((.((((.(((((.((((....((((((....((((((.(((.(((((((((....))))).................)))).))).))).)))...))))))...(((....)))........(((......))).((((.(((....)))))))))))))))).)))))))..)))).))))).....(((((..(((.......)))..)))))..))))))))).))))))...)))))).)))))))))))....)))))))))))).((((.(.....).))))...))).))).))))))))((((.(((((....)).)))))))...........))))...))).)))).....))))))))..((((.....))))..))))))).)))...)))))))...((((.....))))))))....)).).))).))))).))))((.(((..((((..((..((((....)))).))))))..))).))(((((((((((............(((((....))))).....))))...))))))).)))))))))..((((((..(((((.((....))..)))))....)))))).....((.(((((.((((.(((((((((((....)))))))))..((((......))))...((((((((.(.(((((((.....))))..))).).))))))))..)))))).))).))..))......(((((.......)))))..(((...)))))))).)))))))))))))))))))))))).)))))))))))..))))))))))))..........))))))....)))))))))))))))))))....))).....(((...)))....))))).)..)))..)))))))))..))))(((((((.((((....)))))))).)))...))))).)))))))).)).))))))))))..)))....))))((((.((((((........))))))))))......)).)..))))))).))..)).))))))..))).))))))..(((.((.(((.......(((((..((....)).)))))))))))))..)))))))))))))).))))))....)))....)))))).)))....(((.((((((.(((((((.(((((((.....))))(((((..(((((....((((..(((((((((.................))))))))).((((((.(((((((((..(((((.((..(((((.((((((.((((....((((((.(.(((..(((........((((.(((...))).))))..........((....))..)))..))).)))))))..)))))))))...............).)))....))..)).)))))((((((.(((..((((((((((.....))))))..)))).)))..))))))..(((((.....)))))......))))))))............).)))))).....))))((((..(((.(((.((((.........)))))))))).))))......)))))..)))))...(((.(((....))).))).))).)))).))))))))).))).)))))))).))).))))).)))...)))))...)))))))(((....)))........)))))))))).........((((((((.(.(((((((....)).))))).)))))).))))))))))))).((((((((.((((((((((((((.(((((((((((((((...(((((.........((((.(......).))))........)))))............))))))..)))))...(((((......)))))((((.(((.((.((((.((((......)))))))).)).)).).))))...((((((.((..(((((((((......(((..((((((.(((..(((...(((.(......).))))))..)))))))))..)))(((((((.(...((((.((.((((((...((((.((((((((((((((((((..(((((.((((((((((.(((((..(((...(((((.((((((......((((((......(((....)))....)).))))........)))).)))))))((((((.((.(((.(((((..((((.((((((....)))))).))))......(((((................)))))........))))).)))))))))))((((((((..((....))..)))))))).)))....))))).)))))))....))).)))))..)))))))...))))))..))))).)))))))))).))))))(((((((((...((((.((((((((..((.(((..((((((.((((((((((((.((.(..(((.((.((..(((........)))..)))).)))..).)).))..........)))))..))))).))))))(((((..((((((((...((..((.(((((((((...((((((....))))))..(((.(((.....))).)))...))))))))))).)).))))))))))))).(((((.((((.(((.........))).)))).))))).((((.((((.......))))..))))...))).)).))))))))...)))).....((((((((.(((...((((......))))))))))))))).................)))))))))..........).)))))))..............(((((......)))))))))))))).))))))))..((((((.....)))))))))))))))))))).))))))))))))..............))))))))).(((((((((((((((....((((((((((((((((...)))))...)).)))).))).)).((.(((....)))..)).)))))..)))))))))).(.(((((....((((...((.(((.((.(.(((......))))))..))).))))))......))))).)..))))))))......))))))...))))))..)).))))))....))))..)).))).)))))))))))))))))))))....)))).....))))))))))))))).(((((((((((((((((......))).((((((((...(((((((((.((((..(((....(((((....)))))..(((((.(((..(((....))).))).))))).((((..((((....(((((..(((......)))..)))))))))..))))((((((..((.((((((..((((.(((....)))))))..(.(((((........))))).))))))).))....))))))(((((((((...))))))))))))..)))))))))))))..................))).)))))((.(((((........))))).))..))))))))))).)))......))))).))))...))).)))))))))).)))(((((((......))))))).)))))))(((((((.((...((.(((.....))).)).))))))).))...(((((((((((...))).)))))))))))).)).))))))..((((.((......)).))))..))))))))))))))..)))))))))))))))))))))((((....))))........))))))...........((((((((..........))))))))))).))).
Thermodynamic Ensemble Prediction
(((.((((((((((.(((.(((((((.,.((((.(((..(((.((((((((((.((((((((({,(((,.....})),)).))......(((((...)))))...(((.((((({.....})))))..))))))))).)))))))))).)))..))).))))|(({.{{{(,{..((((({(.....,,,,,)))))))))}},.)|{,.(((((.{,,..,..((((((((..(((((....)))))....{(({{.((((((({....))))),|||,,.{{,|||,...(({{,{...{(({|,,...((((,....||||||{{{...((((.(((((((((((((((((((((((((.{....}.))))))))).....))))).))))))))))).))))}))))).,,}))),..,}},....,,,,{{{{|,}||{{{.{{||||.||}}}|,,}}.,,..|,|,,...,))},,))}.))})).,,))},)))))))).......),)))))...},,,(.(((((....))))).)|(((((((...))))))),))))))).))).)))))))..|{,,...,.{{,((....,..((.(((...(((((((.(((((((.{.((((.((((((.(((((((((((((.{{.((.{{.....}}..))..}}))).....(((((((((((....(((((((((((..((({...{((.((((((.(.((((...)))).).))))))))))))))))).))))))....)))))))))))((.{,.((((...(,{((((..((((.((.(..(((((............(((((....(((((((.((({..((((((((.....(((.((((.{.{.(((((((((((..(((((((..,((((,(({(((({.,,.((({{(({.,.|,,,,|||,...||}|||||||||,.{{{,({{{{.,|||{{{{,.{((((.((((.(((((((({((((((,,,,|}}}|||,,...,||||||,|,||},.,..|}.},.}}},..,,|(((((....)))))},,,....)))))))))))).)).)))}}|,,}||,,||||,....{,({((,{((({((.{(,(({{{,|||}..||}||,||},}|,||||||||{{,|||{.,{{(((,(,,|,|.||}||||.((((....)))}....,,(((.,,,((({.((,...,}.}}||,,{..,}))),)}}}.,,,.)))}..)))))}})).,{|{(((((({,{(((((.((((({,(((,..,,|||,|{,.....}}..,,..,})))))))))))))))}}..(((.........}}).{{{....,}||,|||}}}}}.}))})}},}}}|.....,,...,,}}|||{}|||||||,.,,..}})))){{({((|{({(((({.{((,,,{{|||...}}|,((((....)))).((((((((.((({(.{{({.((((..{(({{(,,..|}}|||,.{{{||||{.....}),)}.}..)),))))})).)).))))))))))).(((.((((........)))).)))..,,,,{|,.....((((((.....))))))..}},,,}}}|||...({{{{{{.(((((({{..,{{{{{{..{{{{,(((({{{,,,.(((({,.,}))}}}}}}}}}.((((((((((((((..(((((((.....(((((..,.((.((,{{...,),.)).)).,..)))))...)))...))))...))))))})}}})})},,......}}.....))))})))))....))))))))))))}...}}}}..((((((((....((..(((((((((((.....))))))...)))))..)).))))))))...((((((.({...)).)))))}.||||}|}|||{{|,,.{{{..,},)),...))))),...((((((((...((((...(((((..(((.(((((..((((....(((((((.{....,.)))))))))))..)))))...))).))))).........))))))))))))....||||,,..,...,,,,{||||}|.,|,|||.|||{{{(.|({{.{{.....((((((((....))))))))(((.((((((({,..,(((,((,....))))))}.((((((.((.(((({(..((((((.((((..((.((((((((..,.....,..)))).)))).))....))))..)))))).})...)))).)).))))))..........{(((((.(((...})).)))))))),,)))).)))...)).)))).)).))))),}}.....,(((((.(((,....,.{((((.(((.((((((((.(....,.,))))))))...))))))}.}....}}))}}||(((({{{...}))...)))))},)})))})}}}).))))))))))||..|{{{|,,,.}))),,)}.....)))))))..))))))}))))),..})))).})}....))).)))))..,.))).))))))).)))))....({(........})))))))..).)).))))..))))))..)))),.}}),))))))))))))))))..))))}.)))))||{{{...,),,.)).)))))))..))).))..((((..((((..(((........)))....))))...)))).............||||,||,...((((({...}))))).,((((((.........))))))..,,{{{|||,},..,,,|((((.(((((((((((((((({({.,..{{{{{|(((({((((((((.((({{(((,((,{(((,,((((((.(((({((((((.((((((((((((((...((((..((.((((((((((...(((....))).((((...)))).((((.((.((((..((((((((((...(((....,}),))).))))).))..)))).)).)))).)))))))))).))..)))))))))))),,))))).,.....((.((.(((((((......))))))).}}.)),})))))}..))))...)))))),}}}.,)),)))).,},((((((((.(({(((((...,,..(((((((..........,.))))))))))})),))))))))(((((((...(((((..((((.{.({..{.....}..}}.).))))...))))).((.....,},..(((.(((((((((((((.(((((((((((((({{((((((....((.(((((....((..(((.(((...))).)))..))))))).))....)})})))))))))..........(((((.,.(((((((((((,{.(.((({.{{{,.....,)))}),)}})))))))))))..))))).(.((((((.,(((((((((((.(((((.(((.((.((((.....)))))).)))...)))))..))))))).......,....(((.((((({(({{(((,,..}}}|||..|||,||{,..,||....}))}..,.,|}}||}}}}}}})),))))))).,)))))).).....((((((((.(((((((......((((...((((,,(((((.((({{(((((((.(((.(({,...||.{.........{|(((...))}}).{{,{(({{,,,,.((((((((.((((((....((((((.......((((.((({,..({((,((((({{..,,{{,..|,.}||||,}(((((,(((((((({(((({(({((((,((({{((((((.(((((.,.(((..((((((((.((((((((....(((.(((((((((((((......)))).)))(((....((((((.(.(((,(((.....)))|(((((((((((((..(((.(((((((((...{{.((...}}.))})}},)})))}})))..)))),.((((((,(((.((((((((.,(((((((((,.(.((.((((((((,..,((((({.......,{((,...|{{,,{||.||||{|||{,|}||||}},{(((((({(((,({((((((((.,{{.,,{(((...(((((((,,,,,.,,,,{,}||}}|}.||||.....||}}}.,))}..}}},},,,.})))))),{{{{{{(((((((,.,{,({{{(,,{,..||}||},|.|,|}))|||}}}}}}|.|,|||,,.}|||.|}||||{{{{,...,(((({..(((((,{((({,{(((((..(((((((....)))).))),((({{(,,.,,,,....{{(((((({.{((,,.(((((((((((..(((((((.....((((......))))....))).))))..{((((((((......((((((((((((((,,..}|||..{(({(((({((((..((((.,...,.))))..)))).(((((((..((((......)))).)))))))((((.(((({.,(((.(((.||..(((..(((....)))..)))...,,))).)))|{((.(((((.{(({{{(((((.(({((,.(({(,....|)||||,|}.}}}})|||(((((((((,,..{,(((((((((((...(((...))).)))))).....}}}}}......}}}})))))..,,}}}}...(((((((...{{{{{......},))))){{(((((,((((({{.((((,.((((({.{{.|.||{{,|||{{.|.,,,),))).}}.)))).})).))}))),,,,.{((((.((((.((({...})))..))))))))}|,,...{((((..(((.((.(({{{((....)))))).)).)))..))))))))),),,,)))))))}}}}|((({..,||||,..{{{|,,.,,,...,)))....(((((((......)))))))....(((((.,.....,.))))).{{.(((......,.)))}}..,))))))),(((((((({{(...(((((({..((({...|||.{{{{|.(((((((((((.((((((((((({|||(||,|({|..(((((..(((((((((....})))))))).)))))({(((((,{({,,,,.|{{{,{{((((({(({{..((((.{{|||,...{{,,{,.({(.{(((.(((((,((((...,((((((.,..((((((.(((.(((((((((....))))).................)))).))).)))},)).,.)))))).,.(((....)))...,,.,,|||......))),((((.(({...,))|)))}}))))}))).))}}}||{,||||.}}}||,,...{{{||},(((.......)))..))))),})}}}}))}}..,||}},,|}}|}|,.}}))))},))}.}.,),})))))))))..,{{.,,,...,.)))),..))).))).))))))))((((,(({,{...})),))))}}}..,.,,,.,.,,}}}...})))))}}....}))}))))),}||{{.....)))}..},)))))))))}))))||||}.}.{|{{.....))))}}},,))})).,.})}.))))).)))}((.(((..((((..{{..((((....)))).))))))..))).))(((((((((((............(((((....))))).....))))...))))))),)))))))))..((((((.{(((((.((....))..))))).).,)))))).,...,{{{((((.(({(,{,(((((((((....))))))))).|((((......))))},.|{{{||{(.(.(((((((.....)))}.,|||,|.||||||},..||}|}|,}|||,...,,......(((((.......)))))..|||.,.,})))))),)))))))))))))))))))))))}.))))))))))).|))})))})))}},,......,.}}}}}}....}}}})))))))))})))))..}})))}},,.,...}})}|{,{{{||||||..,,||,||||||,,,..|.|,(((((((.((((....))))))))},))....,.,,.}}},,))},|},|,}}}}.}),.,}}))..))}}},||,|||||,|,,.}},..,})))))})}|||...}|.,..))))))),})..)).))))))..})).)))))),,(((.({.{{{.......(((((..{,....}).))))))})))))).,)))))))))))))).)))))}....)))....)))))).)))..,.(((.((((((.{((((((,,((((((.....))))|||{{..{{{{{....{,|{|,(((((((((.................))))))))).{((({({(((((((((..(((((.((..(((((,((((((,,(((..,,((((((.{.({{..{,,........{(({.(((...))).})))...,|{{{,.((....))..}))}})))})))}})).,)))))))))...............}.)))....))..)).)))))((((((.(((..((((((((((.....))))))..)))).)))..)))))).,(((((.....))))).,....))))))))..,,,.......},})}}))...,|}|||(({(..{((.(((.((({.....,...)))))))))),))))......}}})).,|||||((((({.{{{....})).))}}))),}))).))))))))).)))})))))))).))))))})).))).,.)))))...,))))))|}|......,.,,.,..}))},})))))..,,,,.,,||((((((.(.(((((((....)).))))).)))))),}},}}}}}))))),{(((((({{((((((((((((((.(((((((((,({,{,,,,{((((....|,...{{{{.,......},))}}|,......))))}.,..........|)|||,..}}))),..(((((......)))))((((.{{{.((.(((,,((({......)))))))).)).}}.}.))))...((((((.((..(((((((((......{{(,.((((((.(((..(((...{{(.{......}.)))))}..))))))))}{,|||{((((((,,...((((.((.((((((,..((((.((((((((((((((((((..(((((.((((((((((.(((((.,(((...(((((.((((((.{....((((((......{((....}))....)).))))......,.)))).)))))))((((((.((.(((.(((((..((((.((((((....)))))).))))..},,.(((((................}}))),|||,,.,|}}}}.}))}))}))})({{{{{{{..{|,,,.))..)))))))),)))..}.))))).)))))))....))).)))))..)))))))...))))))..))))).)))))))))).))))))|||||||{|,,,||{{{{((((({{..{{.{{{..((({((.{({{(((((((({{,.{..(((.((,((,,(((........)))..)))).)))..|,}|{{,,,|||.....}||||{.|||||,}}}}}}(((((.,((((((((...{{,.{(.(((((((((.{.((((((....))))))..{((.(({.....})).))}...))))))))))).)}.))))))))))))).,((({.((((.(((.,.......))).)))).))))}.{(({.((((,....,.))}}..))))...}}}.)}.))))))))}},))}){{{,.{{{|||{.,{,,,,,(({(,,,,..}||}}}}}})))))),,,.,,,,}...,.,,.)})))))}}.,,))}},.,),))))))}..,..,.....,..(((((......)))))))))))))).))))))))..((((((.....)))))))))))))))))))),}))))))))))).,.}}}})))...})))..,,,|.(((((((((((((((.,,.((((((((((((((((...)))))...)).)))).))).)).((.(((....)))..)).)))))..)))))))))).|.(((((....((((...((.(((.{(.(.(((......)))}))..))).))))))......))))).}.,))))))))......))))))...)))))),.))||))))},}}}}}))..},,))).)))))))))))))))))))))....)))).....))))))))))))))).((((((((((((((,,{,,{,{((((({((((({{,,,{((((((({,{({,.,(({.,,.|{|{(,{,{||}},,,{{{({.(((..(((....))).))).}}}}}.(({(,,((((....(((((..{{{..,...}}}..}}}}}})))..)))),,,,,,.,{{|((,(((({{(((.(((....)))))))))))}}..||,|||,....,||{|||||||||{{|||}}})))|||||||||...))))}}}))))),.}}}})))))))}|..................||||||||,{{.||||{..}},,..))))),}))})))))))))))}}))......))))).))))...))).)))))))))).)))(((((((......))))))).)))))))(((((((.((...((.(((.....))).)).))))))).))...(((((((((((...))))))))))))}))).))))}))))..((((.((......)).))))..})))),}))))})}..))))))))))))))))))))|((((....)))),.......,}}},,..,|||,....{|||{{{{,,........,}}}}}},)}}.))).

Transcripts

ID Sequence Length GC content
AGACUUCCUGCUCCUUCUACGCUGCAGGUACGCGCGGGCCGGGCGGGGC… 9079 nt 0.5854
Summary

This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]

Forensic Context

A study in porcine skin demonstrated that cutaneous bromine exposure significantly altered the ITPR3 transcript, with increased expression observed at 7 days post-exposure in both the 45-second and 8-minute exposure groups [Price et al. DOI:10.1016/j.toxlet.2008.08.007]. This upregulation was identified as part of the epidermal growth factor (EGF) signaling pathway, indicating its involvement in the molecular response to chemical injury and subsequent wound healing processes.