Basic Information

Symbol
JCHAIN
RNA class
mRNA
Alias
Joining Chain Of Multimeric IgA And IgM IGCJ Immunoglobulin J Chain JCH IGJ Immunoglobulin J Polypeptide, Linker Protein For Immunoglobulin Alpha And Mu Polypeptides IgJ Chain J Chain
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_144646.4
Sequence length
1286.0 nt
GC content
0.3561

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-286.90 kcal/mol
Thermodynamic ensemble
Free energy: -313.77 kcal/mol
Frequency: 0.0000
Diversity: 368.45
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((((.(((((.(.(((.((((.(((..(((((((((...(((((((((((((....))))))).))).).))...))).))))))..))))).)).))).).))))).......((((((((((..(((.....)))((((((.((.(.....).)).))))))..((((..((..((((((((..............((((((....))))))((((((.....)))))).......((((((((((((.((((.(.(((((((.(((((((.....(((((((.....(((..((.((((((.((.(..((((.((..(((.......))).)).))))..).)).))))))..))..)))....)))))))..((((.........).)))..))))))).))))))).).))))....))))......))))))))((((...))))(((..(((.(............).)))...)))(((((......))))).(((.....)))...(((((......))))).))))))))..)).))))........))))))))))((((((((((..(((......((((.((((..((.(((.((((..(((............))))))).))).))..)))).))))......)))..)))))).)))).))))))))).......((((((.((((((.((((((....(((((((.......((((((((.....))))..((((((((((((((...))))))))...............(((((.(((..........(((((((..(((((..((((((((......(((((.....)))))......)))))))).)))))))))))).))).)))))))))))..))))....((((((..(((.(((((.(((.((((...((((((((((((((...........))))))(((.(((.((....((((((.(((((((.........))).))))..))))))....)).))))))................)))))).))......)))).)))))))).)))..))))))..............((((.......)))).)))))))....))))))...........(((((((...((((((((((((....))))........((((......)))).)))).))))))))))).(((((((((....)))))))))....)))...))).))))))......................
Thermodynamic Ensemble Prediction
..(((((((((.(((((.(.(((.((((.(((,.(((((((((...(((((((((((((....)))))))}}}}.}.))...)))}})))))..))})).)).))).).))))).......{(((((((((..(((.....)))((((((.({.(.....|,)}.))))))..,{{{|,{{..((((({{{.....,,.,.....{({(((,,,.}}}}},((((((.....))))))....,..((((((((((((.((((.(.(((((((.((((((((((..,((((((.....,,,..,,.|||||{{(({,,{(,((....{(,(.{{{.,{|||{{..||||,.}....))))}}..),}},))}}}}))),)),.}}.}},.}}}}...,.))),.})))))).))))))).).))))....)))}.....})))))))){{({...})))(({..{{({|,,......,|,.}.,}},|.}},(((((......))))).{((.....)))..,(((({......))))),)))))))),,)).}}}}........)))))))))|((((((((((..(((......((((.((((..(,{(((,((((..{{,............,}}))))}))).))..)))).))))......)))..)))))).)))),)))))))))....,,,(((({(.{{(,{..((((((....(((((({.......((((((((.,..,||}}..{|{{{{{,(((.....,{{|,..,,....{{{.,,,.......((((,({,............,,.((((...})))((((.,,,......||,.))))...})},})},,,,}}}}}}}}},,}},,,)}}},|,}}},)))))))..,,))}},.(((({(,{(((,({{,,,(({,,,,..,,||{{{,{{{{{|||}}}},....,|})},,.{{(.(((.{(....((((((.(((((((.........}}}.})))..))))))....)}.)))))}...........,..,}))))}},,,.,.,,.|}},.}},}))}},|,,..,,}))).,............{{{{.......}})}.}))))))....)))))).,....,....{((((((...((((((((,{{({(,{{{{,........,|||,...}}))},.)))}}})))))))))).(((((((((....)))))))))..,,},},,.))).)))))}..,,,.................

Transcripts

ID Sequence Length GC content
AGAAGAAGUGAAGUCAAGAUGAAGAACCAUUUGCUUUUCUGGGGAGUCC… 1286 nt 0.3561
Summary

Enables IgA binding activity and protein homodimerization activity. Contributes to several functions, including immunoglobulin receptor binding activity; peptidoglycan binding activity; and phosphatidylcholine binding activity. Involved in several processes, including glomerular filtration; innate immune response; and positive regulation of respiratory burst. Located in extracellular space. Part of monomeric IgA immunoglobulin complex; pentameric IgM immunoglobulin complex; and secretory dimeric IgA immunoglobulin complex. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in human subcutaneous adipose tissue from the TwinsUK cohort demonstrated that the JCHAIN is part of a 38-gene transcriptomic signature of obesity, with a positive coefficient of 0.0486, and the composite obesity score derived from this signature, which includes the JCHAIN, correlated strongly with body mass index (R = 0.63, p = 2.87 × 10−71) and fat mass (R = 0.61, p = 6.46 × 10−66) [Francesc Font-Clos et al. DOI:10.1088/1361-6579/aab85a].