| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAGAAGUGAAGUCAAGAUGAAGAACCAUUUGCUUUUCUGGGGAGUCC… | 1286 nt | 0.3561 |
Enables IgA binding activity and protein homodimerization activity. Contributes to several functions, including immunoglobulin receptor binding activity; peptidoglycan binding activity; and phosphatidylcholine binding activity. Involved in several processes, including glomerular filtration; innate immune response; and positive regulation of respiratory burst. Located in extracellular space. Part of monomeric IgA immunoglobulin complex; pentameric IgM immunoglobulin complex; and secretory dimeric IgA immunoglobulin complex. [provided by Alliance of Genome Resources, Jul 2025]
A study in human subcutaneous adipose tissue from the TwinsUK cohort demonstrated that the JCHAIN is part of a 38-gene transcriptomic signature of obesity, with a positive coefficient of 0.0486, and the composite obesity score derived from this signature, which includes the JCHAIN, correlated strongly with body mass index (R = 0.63, p = 2.87 × 10−71) and fat mass (R = 0.61, p = 6.46 × 10−66) [Francesc Font-Clos et al. DOI:10.1088/1361-6579/aab85a].