Basic Information

Symbol
JUN
RNA class
mRNA
Alias
Jun Proto-Oncogene, AP-1 Transcription Factor Subunit V-Jun Avian Sarcoma Virus 17 Oncogene Homolog C-Jun AP-1 Transcription Factor AP-1 Subunit Jun Transcription Factor Jun Proto-Oncogene C-Jun Activator Protein 1 Jun Oncogene AP1 P39 V-Jun Sarcoma Virus 17 Oncogene Homolog Jun Activation Domain Binding Protein Enhancer-Binding Protein AP1 Transcription Factor AP-1 Proto-Oncogene CJun CJUN
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Sudden cardiac death diagnosis Cause of death analysis

MANE select

Transcript ID
NM_002228.4
Sequence length
3257.0 nt
GC content
0.5613

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1243.00 kcal/mol
Thermodynamic ensemble
Free energy: -1299.39 kcal/mol
Frequency: 0.0000
Diversity: 825.36
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((...((((((((...))))))))..)))((((((((.((((.(((((((...((((....((((...(((....((.(((.(((.....))).))).))...)))....))))..........))))...))))))).))))..((((...(((..(((((((((((((((.(((((....((((.(((...))).))))(((..((((((.(((.((((((((((.((..(..((((((.(((.((((((((((..((((((...((.(((.......)))))))))))......)))))).)))).)))..))))))..)..)))))))))..))).)).).))))))....)))..))))).))))))..(((((((..(.((((((..((((((.(((((..((.....))..))).))..))))))..)))))).)..))))))).........(((.((((.((...((((((.((((((....))).))))))))))))))))))(((((..(((((((((((((((((...)).)).)))))))...(((.(((((...((((.((((........))))))))))))).))).((((((((((..((((((((((((((((..((((((((.........)))).)))).)))))((((((((.(..((((((((((..((((((((((((.....)))..))).))))))...((((((..(((((((((((.(.........(((((((((.(.............))))))))))...((.((((...((((((((((.((((((((((.(....((.(((((((((.(((((((((.(((........(((.....))))))..))))))))).)))...)))))).))....)))))))))))...((((..((((.(((((((((...(((...((((((.....)))).))...)))....).))))....((((((......))))))(((((.((.......)).)))))......(((((....))))).....((((.(((...(((((...........(((.........)))...((((.....)))))))))...))).))))........))))))))...)))).))))))))))))))))(((((..((((.....)))).)))))(((((.((((((....(((......)))))))))..))))).........((.((.(((..(((.((..((((((((..(........)..))))..)))).)).)))..))).)).))).)))))))))))))))))....(((..((((........))))..)))((((.....)))))))))).))))....((((((((..(((((.((((((.((((..(((((..((..(((((((..(..(((((((((....((((.((.(((.(((((.(((...(((....((........)).......)))..))).))))).)))))))))((((((((((.......)))))((((.....))))...)))))((.......)).((....)))))))))))..)..))))))).((....))(((((.......)))))(((.(((((((.....))).)))))))...))..))))).))))))).))).)))))..)))))))).......).))))))))..)))))))))))..)))).((((.((((.(((.(....).))))))).))))......((......)).((((((.((...))..))))))................))))))..(((((........))))).)))))).)))))(((((.....((..((((.((((((.((((.......))))......((((.......)))))))))).(.(((((((.....((((((.(((((..(((((((.(.(((..(((((((((((((((.............(((((((((.((.((((((((..(((((((((...((((.(..((((.(...........).)))).))))).....(((((((((..((((((.((((((..(((((.....))))).))))))((((.(((((.......)))))))))(((((((((.(((.....))))))))).))).(((....)))(.((((((((((.(..(...((.(((((.(.(.((((...)))).)..((((.((((....)))).))))((((.(((((.(........).)).))).))))......).))))).)).((((((.(((((....(((((..(.....)..)))))...)))))..))))))..)..).)))))))))).)..((((((.(((((..(((.((((((((((((((.((.((........))))))))))...)))))))).)))..))))).))))))((((((((....))))))))((((((......)))))).((((....)))).....)))))).))))))))))))))..))))..)))))))).))((((((...)))))))))))))))((((((.((((..........))))..))))))..(((.(((((...(((...(((((((((.((.((.((((((.......)))))).)).)).)))))))))...)))...))))).))).....)))))..(((((((.(((((.((((.(((.((.((((....))))..(((((....(((((....(((....)))......)))))....))))).........((((((....)))))).((((........)))).....)).)))..)))).(((((((......)))))))...(((((((.(((.((((((.(((...((((((((((((((...)).))).)))))..))))))))))))).))).)))))))))))).)))))))..)))))).))))...)))...).))))))))))))))))))......))))))).)))))..)).......))))).(((((...))))).)))))))))....)))...))))(((((((.((.(.(((((....))))).)..))..)))))))(((((..((.....))..)))))..............))).)))))..(((((((((((....(((....)))....))))..)))))))........
Thermodynamic Ensemble Prediction
(((,,,{(((((((...)))))))),,}))((((((((.((((.(((((((...((((..,,((((.,.(((..,.((.(((.(((.....))).))).))...))).,..))))....}}....}))}...))))))).))))..((((..,(((..(((((((((((((((.(((((....((((,(({...})).)))}(((..((((((.(((.((((((((({{((..(..((((((.(((.((((((((((..((((((...((.(((.......)))))))))))......)))))).)))).)))..))))))..)..)))))))))..))).)).).))))))....)))..))))).))))))..((((((((((((((((((.(,,.((((((((({((((.,.(({....}))....((((((((.(((((((({...........}.)))).)))).(((((((((((.((((((....)))},))))))))).)))),..(((((((((((.(((((((((((,....,.)).))))))(((.....))))).))))}}}))))).....)))))))){{.((((((...(((((((.((.(((.((((({({({{(({,({{{.||.{({,{((({{(((((((((,...))))))){(,((,((((({(,((.{,,,,,|{||.|}}}}.})..)},))}))))))}.,}}.((((.((((((((((((((........,,||(((((.((((...........(((((((((((((((((..{{.((.(((((((((((({((.(..((.......,))..),)}))))))))}.......}})}})}.}).....))))))))))))))))))))).))))),.(((.((((...)))).)))..)),.,))))))))))).)))).,{{...((((((.....)))).))...}}}...{{{..{{{..{((((({......}))))),,{,,,||..}},..)).,})))}}))}}}}}}).)})))))|{,,.,||.,.{,,...,..,......}}}...))).))..)))))))....)))))).}),.))))))))))))).{{(((.(((((.((((.....{{{{(((((((((.((((.(((...((.((((.((((.(((((((...)}),.)))).)))))))).}}{((((((((((((..(((((((....((((((.(((..((((..,(,.{...(((((((((..(,{((((((.,.{(.((({{{(({({{({{{|||}.}})),,))}.)}}||(((.{.......}.))),,....,|)}}}.}),})))))))))).)))))))..)),....))))..))).))))))...((((((..((,.(({.{((,.(((((((..(..(((((((((....((((.(,{(((.(((((.(((...(((....((........)).......)))..))).))))).)))))))))((((((((((.......)))))((((,...,))))...)))))((.......}}.{{....)})))))))))..)..))))))).}}...}}}),,}}..))..))))))(((.(((((((.....))).)))))))...))))))).((((((((((........((((((,.(((((..{(,{..,|.,((((..(((({..{{,.(({{,.((((.((((.(((.{....}.))))))).)))),...},||......}}.((((((.{,...,}..)))))).{{{{............)))),,.{((((......,.))))}(((.......)))....,)))).)))}.},.(((({{(,((((.......))))..}}..||||.,....,|||,,({||((((..(((....)))..)))))))..}}}}||,........,))}}))))),..))))))............................,.((((((.........)))))),,..((((.{...........).)))).........)))..)))))))...))))))))))))}((((,..{{{|||}|{{{,.((.((((.(((((((..((.{{,((((.(((((((({{(((.....))))))))).)))))))...})}))..))))))))))).))))))}}}),,,)))}.{(((({{.{{...}}.}}}}|||.....,,,,..,|,((((.(((({.{........).)).))).)))).......))),)})),,))))))))).....{{{{(...,,,,,|||||{|||{,|,|||}||.{{{{{,..,.........}}})}}}}}))||).))))).))))).),)}})))))))))))))|((((((.{.(({...{({.....})).},,)))).))))})}||||.,((((((({....)))))))}....,,,....((({{{((((.({{.......}}}.))))))))),,..||{||||,.((((((((((((,....(((((((...))))))).........))))))))))))..((((((((..((((,{{{...,,}|||...,{{.{{{.(((((((((.((.((.((((((.......)))))).)).)).)))))))))...}}}.,,),}}|{|......}}}.,({(,{(((((({.((.((((({.,(((((.....))))))))))).)).)))))))})}.}......{{{....,}}))))..))))))))...,,,...{(((((....)))))},{{(({{,,{{.{{{|...,,,,.},..}}}|{||(((((((......))))))).,,|{{(((({({(,((((((.(((...((({((((({({{{...)).))).)))}},}))))))))))))).))},))))))},,,|||||,|,{{.((({|{{(((((..{{((((((........))))}})))...))}})))),.))},))})..))}}},.....,,},||||{...})))),)))))))))..,,)),...))))(((((((.((.{.(((((....})))).}..}),.)))))))(((((..((.....))..)))))..............))))}})))..(((((((((((....(((....)))....)))),,})}}))}........

Transcripts

ID Sequence Length GC content
GCUCAGAGUUGCACUGAGUGUGGCUGAAGCAGCGAGGCGGGAGUGGAGG… 3257 nt 0.5613
Summary

This gene is the putative transforming gene of avian sarcoma virus 17. It encodes a protein which is highly similar to the viral protein, and which interacts directly with specific target DNA sequences to regulate gene expression. This gene is intronless and is mapped to 1p32-p31, a chromosomal region involved in both translocations and deletions in human malignancies. [provided by RefSeq, Jul 2008] CIViC Summary for JUN Gene

Forensic Context

A study in mice demonstrated that the JUN (Jun protooncogene) is a key gene identified in severe burn wounds, with its mRNA and protein expression levels significantly increased in burn tissue compared to normal skin [Guo et al. DOI:10.1155/2022/5220403]. A study in mice demonstrated that a single high-dose chlorpromazine administration did not alter the JUN expression, but repeated high-dose administration for 3 and 4 weeks significantly decreased its mRNA levels in the heart, suggesting a down-regulation to avoid cardiomyopathy [Sakai et al. DOI:10.1016/J.Legalmed.2010.07.005]. In a rat model of heat stroke, transcriptomic sequencing and machine learning identified the JUN as a key target, with its protein expression significantly up-regulated in myocardial tissue and associated with mitochondrial disruption and increased apoptosis, while its pharmacological inhibition improved mitochondrial membrane potential and reduced cell death [Xiang et al. DOI:10.2147/JIR.S517319].