Basic Information

Symbol
JUNB
RNA class
mRNA
Alias
JunB Proto-Oncogene, AP-1 Transcription Factor Subunit Transcription Factor AP-1 Subunit JunB Transcription Factor JunB Transcription Factor Jun-B Jun B Proto-Oncogene Activator Protein 1 AP-1
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_002229.3
Sequence length
1830.0 nt
GC content
0.6486

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-821.20 kcal/mol
Thermodynamic ensemble
Free energy: -851.81 kcal/mol
Frequency: 0.0000
Diversity: 429.84
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((.......((((((((((((((((((..((.....))..))))).))))).......(((((((((.......(((.(..(((((((((.(((((((((((((((((((....))))))).((((....((...(((((((.((.........)))))))))....))...))))((((.(((.....))).))))..(((.((((.((((.....)))).)))).))).(((((((.((((...(...((((...))))..).))))))))))).((((..((((........(((((......)))))....((....))...))))....))))......)))))))))).)).))).)))))).).))).......(((........))))))))).)))..)))))))).......(((((((((((.......)))))))).))).....((((...))))((((((((.((((((((((.....)))...)))).(((((.(((.((((.(((..(((((.........)))))))))))))))..)))))....((((..((.(((((((.......(((...((((((((((...(((....)))..)).))))))))...)))(((((((.((((((((((..(((((((((((....(((((((.(((((((((((((...((((((...)))))).(((...((((.....))))...)))...(((((........)))))(((((((.(..((((((...))))))..).)))))))((((....)))))))..)))))..))))).................(((((....(((..((((((.((....))))))))...))))))))(((((((..(((....)))..)))))))..........))).))))......)))))))))))(((((.(((((.((((((...))))))....))))))))))(((((........)))))..((((...(((.(((((.(((((.(((((((..(((...(((((.(((.(...((((....)))).).)))....((((.(((...))).))))..))))).)))...))))))))).))).))..).)))))..)))).((((((.((.((((..((.((((((((....((((....))))..((((((.....((((.(((....))).)))))))))))))))))).)).))))))))))))....(((((((((.((((((.((..((((.(((((...))))).)))))))))))).)......))))))))..)))))))))).)))))))((......))(((..((((.((((((((.((.(((((((.((((...)))))).).))))(((((....)))))..(((...((((((.((((....(((...)))....)))).))))))))))).)))))).)).))))...))).........((((((.(((((.(((((..((((..((((.(((((....))))).))))(((((....)))))((((((.....)))))).....)))))))))))))).))))))))))))).))..))))))))))))))).(((......)))...(((((....(((.(((((........))))).))))))))..((((((......)))))).((.((((((((((...((((..(((.......)))..))))............)))))))))).)).((((((((...........)))))))).......)))))).......
Thermodynamic Ensemble Prediction
((({{(,,{{(.,((((((((((((((((((..((.....))..))))).))))),,....|(((((((((...,...{((.{..(((((((((.{((((((((((((((((((....))))))).((((....{{|..(((((((.((.........))))))))),,|,||...||||({((.(((.,,,,|}},||||..(((.((((.((((.....)))).)))).))).(((((((.((((,|.|,..(((,...}))),.).)))})))))}},||{|}.||||,.......{(({,......,}}},....,,....,,...}}}}....))))......))))))))))},).))).)))))).}.))}.......(((........)))))))))}|))..)))))))).,,.,..(((((((((({.......)))))))).)))..,,,{{{{...))))((((((((,((({{(({{{.....)))..,)))).(((((.(((.((((.{{{{.{((((.,.......)))))))))))))))..)))))....((((..((.(((((((.,,.{{,{((,..((((((((((...(((....))).,)),}))))))),,.}))(((((((.((((((((((,,(((((((((((....(((((((.((((((((((((((..((((({...}))))).(((,,,((((.....))))...}||{{{{,,,,......,})))||(((((((.(..((((((...))))))..).)))))))||||,,,,}),))))..)))))}.})))).{,,.......,,....(((((....(((..((((((.((....))))))))...))))))))(((((((..(({....}))..)))))))..........))).))))......)))))))))},((((({(((((.((((((...))))))..,,}}))|)}))}(((((........)))))..{(((...(((.(({((.({(,({(((((((..(((,..(((((.|{||{|..((((....))))..,))}....((((.((,...,)).))))..))))),)))...))))))))))))).))..),)))))..)))).((((((.((.((((..((.((((((((,...((((....))))..{(((((.....((((.(((....))).)))))))))))))))))).)).))))))))))))....(((((((((.((((((.(,..((((.(((((...))))).))))}))))))).}},....))))))))..}|||||||||,|||}}}}((....||||.,{..{(((.((((((((.||.|||{{|{.{{||,,,)))))).),)))}(((((....)))))..{||...((((((.((((....(({...}))....)))).))))))))))),))))}).)).)))),,})},)},......((((((.(((((.(((({,,,{((.,((((,({{{{....))))),)})){{{({....))))}((((((,,...}))))),,,..},)))))))))))).))))))))))))).))..))))))))))))))).{|{.,,,,,))),{.(((((....(((.(((((........))))).)))))))).}((((((......)))))).((.((((((((((...{{({.,(((,.,,,,.,}}..))))......,.....)))))))))).)).{{{{(({{{((....,||.}}}}}}},.......))))),.......

Transcripts

ID Sequence Length GC content
GGGACCUUGAGAGCGGCCAGGCCAGCCUCGGAGCCAGCAGGGAGCUGGG… 1830 nt 0.6486
Summary

Enables sequence-specific double-stranded DNA binding activity. Involved in positive regulation of transcription by RNA polymerase II. Located in nucleoplasm. Part of transcription factor AP-1 complex. Implicated in head and neck squamous cell carcinoma and melanoma. Biomarker of gastrointestinal system cancer (multiple); lung non-small cell carcinoma; and lymphoma (multiple). [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in rats demonstrated that the JUNB gene is a potential diagnostic marker for fatal hypothermia, as its expression in the iliopsoas muscle was significantly increased only by severe hypothermia and is involved in metabolic state and lipid metabolism [Umehara et al. DOI:10.1007/s00414-018-1888-3]. In human sepsis research, the JUNB transcription factor was identified as a biomarker, being highly expressed in almost all peripheral blood mononuclear cells and significantly up-regulated in sepsis patient blood samples as part of the IL-17 signaling pathway [Zhao et al. DOI:10.1016/j.imbio.2023.152763].