| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGGACCUUGAGAGCGGCCAGGCCAGCCUCGGAGCCAGCAGGGAGCUGGG… | 1830 nt | 0.6486 |
Enables sequence-specific double-stranded DNA binding activity. Involved in positive regulation of transcription by RNA polymerase II. Located in nucleoplasm. Part of transcription factor AP-1 complex. Implicated in head and neck squamous cell carcinoma and melanoma. Biomarker of gastrointestinal system cancer (multiple); lung non-small cell carcinoma; and lymphoma (multiple). [provided by Alliance of Genome Resources, Jul 2025]
A study in rats demonstrated that the JUNB gene is a potential diagnostic marker for fatal hypothermia, as its expression in the iliopsoas muscle was significantly increased only by severe hypothermia and is involved in metabolic state and lipid metabolism [Umehara et al. DOI:10.1007/s00414-018-1888-3]. In human sepsis research, the JUNB transcription factor was identified as a biomarker, being highly expressed in almost all peripheral blood mononuclear cells and significantly up-regulated in sepsis patient blood samples as part of the IL-17 signaling pathway [Zhao et al. DOI:10.1016/j.imbio.2023.152763].