Basic Information

Symbol
KCNA1
RNA class
mRNA
Alias
Potassium Voltage-Gated Channel Subfamily A Member 1 Kv1.1 RBK1 HUK1 MBK1 Potassium Voltage-Gated Channel, Shaker-Related Subfamily, Member 1 (Episodic Ataxia With Myokymia) Voltage-Gated Potassium Channel Subunit Kv1.1 Voltage-Gated Potassium Channel HBK1 Voltage-Gated K(+) Channel HuKI AEMK Potassium Channel, Voltage Gated Shaker Related Subfamily A, Member 1 HBK1 EA1 MK1
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_000217.3
Sequence length
7985.0 nt
GC content
0.4670

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2529.00 kcal/mol
Thermodynamic ensemble
Free energy: -2673.78 kcal/mol
Frequency: 0.0000
Diversity: 1728.32
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((..(((((((.((((((((((((..((((((....(((.(((.....(((((....)))))..))).)))..)))).))..))))).)))))))((((((((((((((((.((((((..((((((((((.((......)))))))))...(((((.((((((..((((((........)).))))........)))))))))))(((..(((((.....(((...((((((((....)))))...((((((............))))))....((((((((..(.....)..)))))).))((((((((((((((.......(((((..(((((..((((((((.((((.((((......(((((((((.((((((....(((.((((((.((..........)).)))))).....((.((((((.....)))))))))))....)))).)).)))))))))((((((..(((((((((((((((..(((..((.....))...))).........((((.....((((...))))...)))).((((((..(((....)))..).)))))......))))))))))))))).....)))))).((((..(.(((((.(((((((((((((((..((.(((((((..((((.((((((((.((((((((((.(((((..(.((((.(((((.(((....)))..))))).(((..((((.(((((..((..........))..)))))......(((..((((......))))..))).((((....)))).(((....)))............................))))...)))...(((..((((((((.....(((...(((.(((....)))..))).............))).....)))))).))..)))...)))).)...)))....)))))))))))))).)))))).((((....))))........(((((((.(.....).))))))).((((((((((((.....)).))))))))))......))))..)))))))....))..))))))))))...))))).)))))).))))....))))((((((((((.((((..(((.((...(((((.((.(...((((((...((((((((((....)).))))........))))..))))))...)..)).))))).(((((...)))))..((.(((....))).))((((((((((...)).))))))))..((((((((((((((..........))))).((((..(((..((..((((..(((((.(((((.(((((...(((......(((((((((...((..((.(((((((((.(((....(((((...........(.(((((..(((....)))..))))).)((((((((...)).))))))....)))))......)))....)))))))))..))..))..))))))))))))))).)).)))))(((((.((..((.(((((.....)))))..))..)).)))))...)))))...))))..))(((((.((.......)))))))..)))))))))))))))).)).))).)))).))))))))))..)))).))))))))..)))))..))))))))))))))..((((...(((((...........)))))))))...)))))...)))..)))......)))))..)))..................)))..))))))......(((....))).((((((((((.(((((......)))))))))))))))))))))))..))))))))....)))..(((((.....(((((((...((((......(((((((...(((((((((((.....((.(((((((.((((((.((((....((((.((...((((...(((......)))......)))))).))))(((((((((..(((((.((..(((((...((.(((.(((((((.((((((((((((((((((.(((...((((.(((((((.((((....(((((.(((.(((((..(((.(((((.((((((((.((((..((((((.((.((((........)))).))))))))..)))).)))))))).)))))...........((((((...))))))(((((((((((((((((.......)))))))).(((((((((((((.((((((.((....)).)).((((.......((((...((((..((((((...)))).))..))))..)))))))).)))).))))))))))))).................))))).))))(((((((.....((((((......))))))((((((((.....(((...)))...))))).))).))))))).)))..)))))))))))))))))...))))).)).)).))((((.(((((((....((((.(((((.((((.((((((((.((((.((..(((((..((((....(((((((..((...........))(((((..((((((.(((..((.((..(((((...)))))..))))))).........(((..(.....)..)))................................(((((....)))))((((.(((((...))))).))))..........))))))..)))))..((((((((....))))))))(((((((((((((((....))....)))))))))))))................((((((.(((......))).))))))((((((((((((((((.....(((((((...(((((.(((......))))))))..............(((((((((((((.((((((((.((((...)))).)))))))).(((((..((((((................(((((...(((((((((...((((.......((((..((....((((.((((((.(((..(((((.............).)))))))..)))))).))))..))..)))).....(((.......))).))))......)))))))))....)))))((((((((((((((((((((((((((((.((......((((((((((((.((.............(((((((.(((((((....)))).))).)))))))...((((((((((....(((((......((((((....((((...))))..........(((((((.....))))))).((((((((((((.....))))....)))))))).((((((....(((((((.........)))))))............))))))......))))))........(((((.((.((..(((......)))..)).)).))))).....(((((((........((((.....))))........)))))))))))).....)))))......)))))..)))))))))...))))).....((((....)))))).))))))...((((((.......))))))........((((((.((((......)))).))))))(((((.......)))))((((.(((((((((((((..............((((..((.....))..))))...............))))))))))))).))))))))))...))))..))))).)..))))))..))))))..))))).(((((....)))))...(((((.((((.....)))).))))).....(((((((((((.(((..((..(((.......(((((.((((.((((((.((((((.....)))))).))..)))).))))))))))))..))..))).)))))))))))..)))))).))))))).........)))))))............(((......))))))..))))))))))))).(((.............))).............................(((((.(((((....))))).))))))))))))......(((((((.((((.............)))).)))))))...))))..))))).........((((((((......(((((((((....))))))))).((((.....)))).....(((((..(((((..((((((......)))))).)))))..)))))((((((....)))).))))))))))((((((..((((...((((.(((...(((((((((((..((((((((((((..((((((.........)))))).)))))))))))).(((((.(((..((((((....))))))....(((((((((((((((.((((((.((..(((((.(((((((.((((((.....(((((...........))))).....)))))).....(((((((((((((((((.(((((.........(((...((((.........))))..)))....((((((((.((((((((........((((((.....))))))..((((((((....(.((((((..(((((....)))))..)))).)).)...)))).))))...............(((((((.....(((...)))........)))))))....)))))....))).)))..))))).)))))....)))))))))))........)))..)))...))))))))))))..)).))))))....................(((.(((..(((((............))))).))).)))((((..(.(((..(((((.(((.....((((((((.((((.((((....(((((((((((.......))))).))))))...(((.(((.((.((((..(((((.((..((((((((((((...((((..(((((.((((..(((.(((.((((....(((....(((..((((.....))))..)))....)))..)))).))))))..)))).)))))..))))..))))))).))))).(((..(((((((((((.((....((((..((((.....)))).))))....((((((((...(((...))).)))))))).........)).))).))))...(((((((((.(((((..((.(((..((((...))))..))).))..)))))...)))))))))))))..)))...)).)))))..)))))).))))))......)))).)))).((.((((...((((((((((....(((((((((((((((.(((..(((((((.(((............))).)))))))..))))))).......((((....))))(((....(((....)))....)))(((((.(...(((((...................))))).).))))).........((((........))))...)))))))))))))))))))))...)))).)).......))))))))....((((....))))(((....))).(((((((((..(.(((..(((((((((.(((........))).))))))))).))).)..)))))))))))).)))))..))).)..))))...))))))))))))))).))).))))).)))))))))))))).))))(((.(((((((.((......((((((.(((.(.(((..(..(.((((((...)))))).)..)..))).)..)))...)))))).....)).))))))).))).....((((....))))...)))).))))))........((((((..((((((.((.........((((..((................)).))))...........)).).)))))..))))))..((((((...)))))).)).)))).))))..(((((((((....)))))))))....)))).))))...))))).)))).)))))))..))))..))))))))).......))))))))).......(((((((.((((.((((...(((((((((..((((...))))..)))))))))...))))....(((((((..(((((.((...............)))))))...))))))).((((((......))))))...((((((.....(((....)))......))))))....)))).))))))).....((((((((..(((.((.((...((((...)))).....)))))))...))))))))......))).))).)))).))).))....)))))..)).)))))((....((((....)))).....))(((((((((((...)))))).))))).((((.((.......(((((....))))).(((((..(((((((((((((((.((((((.(((((((.(((..........((((((...(((((..(((((((..((..((((((...))))))..)).....((((.....)))).)))))))....(((((....)))))..........((((((...))))))...............((((((((................)))))))).............((((((((((((((((..(((((((((...............)))))))))....((.(((((.................)))))))(((((((((((((((((...)))))))))))....))))))..((((((((...))))))))....)))))))))))))))).........))))).....)))))).............)))))))))).......(((((((((((........))))...)))))))...............))))))((((((((((..((...))..))))).)))..)).((((((......)))))).)))))).....))))))))).)))))..(((..(((((((((((...(.(((((((((((.(((((((((((((((..((((((((((((((.......)).))))))).))))).........(((((....(((.....)))....))))).))))).)))))).(((............))).))))))))))...))))).).)))))))))))..))))).)))).(((((....)))))))))))))))))).))))))...))))))).))...)))))))))))(((((((.......)))))))((((((..(((((((...(((((((((...(((..(((......))).))).)))))).)))..)))))))....)))))).....((((((.......))))))...))))))).......))))..))))))).....)))))...........((((((....)))))).......))))..)).........((((..(((((.(.((((((((.......))))).......)))..).)))))((.((((((((.(((((((((((((.((((((((((...))))))(((((((((.................((((((((.((..............)).))))))))((((((((.(((...((.(.((.(((......(((((((.(((((........)))))...)))))))))))).).))....))).))))))))))).))))))..........(((.((((((((.....(((((......((((((((.(((((((...))).))))))))))))....))))).......)))))))))))...........((((......))))...)))))).)))).)))))))))))...)))))).....((((..(((...)))..))))....)))).
Thermodynamic Ensemble Prediction
.(({{(((,,{{.((((,,.,{||||.((({,(,{{{(((.(((((((((((((.{{{,|{{|{{{,,({{.{,||||.|(({{||||.},,,},)})))))})})}|...))|,,|||}....(((((((.((......))))))))).,,(((((.((((((..((((((........)).))))........))))))))))).|.(((((((((.(((((,,(.(((((.((((((.(((.((((.(((((((({..,(((((((({{.{.((((((((..(.....)..)))))).)),}..))),(((((.(((((....))))).).)))}.(((((((((((((((((.....((((({..{,((((......)))}..........{(((.((({..(((((((((.((((({(((.((......(((((,,...,,.(((((((((((.((((,.(((((({{(((((((((((((((..,{,..,{,,{,..|{{{||..........((((.....((((...))))...)))).(({(({..{{{....)))..),)}))),,,...))))))))))))))).....,))))).}}).....(((((((((.(((((((((..,.((((((((((.{{((((((((((((((.((...(((((...))))))).))).(((((((.((((((((...,(.((((..((((((((((((.((..((((......((((.(((((((......))).)))).)))){((((((.(((((((((.{({....})}...........................{{{{{..............,{,,,((({....,,||}}..,,||{....))),,))))),,{(,...,,|,}}......|||{{,||((({{..,,(((((.(({{((..((((..,......)))).))))).)))))...,.)))))))))|((((((.(.....).))))))}.((((((((((((.....)).))))))))))))))))))).)).))))).......)))).)).}})))))))))))..)))).,(((((...(((,{((((((((.((((..(((,((,,.(((((.{{.,...(((((({{{{,(((((({(,...)).)))}......,}}}))}.))))))}},)|.,,,|||||.(((((...)))))}}||}{,|....,)),))(((((((({{...,}.))))))))..((((((((((((((..........})))),(((,..|||..{(..((((.,(((((.(((((.(({((...{{{......(((((((({...((..((.((((((((({(((....(((((........,..(,(((({{{((({{..|}}..))})).}.,||,|||.},))}),})),....)))))......)),...,)))))))))..))..))..})))))))))))))).)).)))))(((((.((..((.(((((.....)))))..))..)).)))))...))))).,.))))..))((((..,|}}}.{{{|||,,,,}})))),,)))))))))).,}.))).)))).))))))))||((((((({{(((((..(,{{.....}),.)))))).((((...))))})}}))))))}..))).....)))))(((.(((((((....,,......,,{{||,.,,,,,..............,,,{|,.....,,......}})))...}))))).....(((((((.((((((..(((((.((((,({.....,)).})))))))),{({.,,...}}}}..........((((...{{{{{|...,))))}...}}}}...............(((.(((.........))).)))..))))))))))))).((((.(((..(((,.((((..((((......((((((....((((({..,((((((...))))))))))))...(((((((.(((..((((..((((...)))){{(((((.((((....(((((.(((.(((((..(((.(((((.((((((((.((((..((((((,(,.((((........)))),),))))))..)))).)))))))).))))}.|,.,,,,,,.((((((...))))))(((((((((((((((((.......)))))))).(((((((((((((.((((.,.{,{.((((((..((((..{{{({((((.........)))..}}}.))).))))..)))))),}},),..)))).))))))))))))).................))))),)))){{{{{{|,,,,,((((((.,....))))))((((((((.....{{,...,})...))))).))).}}}}))).)))..)))))))))))))))))...))))).}}...((((....((((((((((((........))),((((,......((((((((..(((((.....(((((((({....|}}((({{{....|}.}}}}....((((..(((..((.((..(((({...}))))..))))))}..........|,......}})).)))}...............................(((((....)))))(((((((.,.(((((....|})}}...{{((((((((((.........((((((((....))))))))(((((((((((((,,,...,),...))))))))))))).............{{.(((((((,{{......,}}.))))))).))))))))},})))}}.{{(({|{|...,,)..))))}....((((((((((((((((...........,,,,.......{(((((((.((({...}))).))))))}|,{{,.,,,,,.,|,,....,(({....,{.|||((,.,({({((((({..,,,,....||.((((..((....((((.((((((.(((,.,((((....,....,,..}.)))))))..)))))).))))..))..))))...,.{((.......))).,.,|{{{,..|,}}}))))}}},)))}}.)),..}})}}},)}.,.}})}},...,,},.........)))))),}))))))))))))))))........))))))...)))))..)))))))),(((.....,))})))))..,))))))))....)))),,...,|||...}}},...{{{.(((((((({.((((((((((((.((((((((((((.....,)))....)))))))).,.,,.{{{{{(((,,(({,,..{.{{((,.{((.,..{{{.....}))....)))..}}||,||,,,,...(((((.((.{{..(((......)))..,}.)).))))}.....(((((((...,....(({{.....))})........))))))),,,{{(({..(((........))),...})))}..,.(((((..(..{{{.........)))..}..))))),,|(({{|.......)))))}...,,..,{(((((,({({......)))),))))))}.,}))))}}}.|||||(({(.(((((((((((((..,.,{,,{,....((((..((.....))..)))).....}}..,},},.))))))))))))).)))),}...))))))))))))...})),)))))),,}.......,.....(((((....)))))...(((((.((((.....)))).)))))....,(((({((((((((,((((((({({{{,..(((((((((........)))))))))..,,({,{,,,((((((({(.((((((((,(((,....(((((,...(((((...))))).).)))))......}}}....,(,((((((({.((((.(((...((((({((({......,}))},,..{{{,..,.........}||...........,,....................})))).....})),)))).)))))))),.,,,,,.(((((((.((((.............)))).))))))).,.((((((..((.....,),.)))))).,.,...,.,((((((((....))))))))},,}}}}.{{{,{||...)}}.)))..(((((..((((({......)))))).))))))))).)}.))))))),||||{.,..)))}.,..}|}|}}}}|,,..,,((({..,((((({(((,,{(...,{{{((((((({..(((((({({......,},,,,.,,,,,,,,},||,{,||}.|||.}|,,,....,,)))})))),.................{{|((({((.{((({{{(((((((.((((((.....(((((...........))))).....)))))).....{{{{{{(((((((((((.,(((,....,....({{,,.{{{{.,.......)))}.,|||....((((((((.((((((({........((((((.....))))))..((((({{{..,,(.{{,{{|},||{{|,,,,||)})|,|}|}.}},|,.})))},))),...............(((((((.....(({...}))........)))))))....))}}}....))).)))..))))).}}))),...)))))))))))....{{,.,,,.})),...)))))))))))).}.))))))}}.......))),)))))),},..}}}))))||{{({,{{........}||||,,...}}}))))))})))))})))))))}..}}},))))..))).)))))))))))))((((((((((.......))))).)))))...))))...)))).,.))).)))))))..)))))))..)))..,...))))))))..)))))))..(((((.(((((....))))).)))))(((.....))))))))))))))..,.....,,..{{{.{((....))}...}))}})))))))))).....))))))))).)))))))))....((((..((((.....)))).))))....((((((((...(({...})).)))))))).............,.(((...(((((((((((.(((((..,,,(((,.((((...))))..})),))..)))))...)))))))))))..)))....))))))))))))))),..,.))))}.....,)).))).)).}..},,)))..))))))))).)))}..)))}...})))))))))))))))))............)))))....)))))))))))))).)))))))..)))))),)}||,....(((....}}}....},,(((((.(...(((((...................))))).).))))).,,....(((((((((......)))).)))))}))),)),.)))))..)))))))))|,.((((.(((((.(((....((((....))))(((....)))((((((((((..(.(((..(((((((((.(((........))).))))))))).))).)..))))))))))))).))))).)))),)),}}}.))))))))))))).||,||}...}}|..|||{|{,,{{{(({,.{{{{||,,{{||||}}}}.((((((..((((((..((((,({,...))),))}|(({{,,{{||||...{{.,{,....,,},..,,..,,{(({......)))),)|.,,,..{((((.(.(((((.(((((((((........{.(((....})).,.(((((.....)))))((({{(((((..((((((((...((((((..(({.((,((((.........(((((((((((((...))))))..(((((((,.....(((((((((....)))))))))....,.((((((({..,,,..,,,{{,{(({(,{,,.(((((((..(({{{{.,,,,,))))}),,}))}))),))),,((((((..((((...(((((((((..((((...))))..)))))))))...))))..)))))){(({{,,((({(,.........{{{{{{||{|,||{{.||||,,..||{||{,,,,,{||||,|{{{(((((.(((((((((..((..(((((,((((,((((((((((...(((((((.,((((((((..(((.({{((...((((...)))).....)))))))...)))))))),...{(((({(((((((((.............{{,...{{.{(((((.....)))))},||||,..}})(((((((((((...))))))},))))...))}))))))...)))}}...)).))).))...)))))))))).....((((({.((((((((((((((((((({......{(((((({((({..(((((((..((..((((((...})))))..)).....((((.....)))).,)))))}...,(((((....)))))}.........,{{{{|,,,))}}||{{{,...........((((((((................))))))))............)))})),..,...,))))}))))))))))))....))))))))))))))...)))}))))).....))..)))))))))...))))).......,((((((((((...))))))))))}}))},}))}}}.((((((((...)))))))).,,......((.((((((.((((((((((,,,..,,...|,|,,,,,,{{({,.((((....,,}},,)},})),}||,,,,),,)))))))))).)))))).))...........,............,,((((((((..(,...})..))))).))).}))}||||||}}}},,))))}|((((.((((({,{{..((((.((((........)))}..))))}})))))).,})))|,,.....{(((((((((({..{{{{,{{{{{(((,,{,,.,,|},|}}}}}),}}))).,}},.,,,(((((.,..(((.....)}}..,.))))).)))))}})))))}((((({...{{.....,|{||}}}}...,{{{{{..{((((((({(((.{{{..{(((,((,,,,,,||}..})))...||.,,|{(((({(((...))))))))))|||||..|||||||||,,|||||||.,,,.}})))))))))|{}}}}||,{{|{...{{{((((((...(((,.{{,......))}.))).)))))).}}|,||}}}}},.}),))),.}}}))...|,((((((({...})))))))}........((,{(((((((.(((((.{(((,...............((((((....))))))......,}}}|((.{,....}}.,,.,{{{.{{,...})}.}}}.)))))))))))))))))))))))..,,.,})))))((((((((((.....)))..}))))))((((((...))))))..)))))))......}..)))).)),))).....)))))).))))))))...)))))))))........))))))))).))))).).))))}))))))..)))))}....,}))}}))),}||||||||..{{{{{{{.|,........||||,}}}}.,.|||.,}}},,,,}}},,)))},)}),,)))|||{{{{,...,.|(((((((.(((((((...))).}))))))))))}....)))),..((((((((((((((((.......))))))..........,,....||,.......||......|,....,,))))))))))(((({.(({...,)),}))))..,,}}},.

Transcripts

ID Sequence Length GC content
AGAAAUGGACCGAGCGGACCCGCCGCCGCACGCACCCUGCUCCACUCCA… 7985 nt 0.4670
Summary

This gene encodes a voltage-gated delayed potassium channel that is phylogenetically related to the Drosophila Shaker channel. The encoded protein has six putative transmembrane segments (S1-S6), and the loop between S5 and S6 forms the pore and contains the conserved selectivity filter motif (GYGD). The functional channel is a homotetramer. The N-terminus of the channel is associated with beta subunits that can modify the inactivation properties of the channel as well as affect expression levels. The C-terminus of the channel is complexed to a PDZ domain protein that is responsible for channel targeting. Mutations in this gene have been associated with myokymia with periodic ataxia (AEMK). [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the KCNA1 was identified as a differentially wired gene in the prefrontal cortex of animals selectively bred for high versus low methamphetamine consumption, indicating its involvement in the transcriptomic basis of addiction risk [Hitzemann et al. DOI:10.3390/brainsci9070155].