Basic Information

Symbol
KCNA2
RNA class
mRNA
Alias
Potassium Voltage-Gated Channel Subfamily A Member 2 Kv1.2 HK4 Potassium Voltage-Gated Channel, Shaker-Related Subfamily, Member 2 Voltage-Gated Potassium Channel Subunit Kv1.2 Voltage-Gated Potassium Channel HBK5 Voltage-Gated K(+) Channel HuKIV NGK1 Potassium Channel, Voltage Gated Shaker Related Subfamily A, Member 2 Voltage-Gated Potassium Channel Protein Kv1.2 EC 3.6.1.27 EC 6.1.1 EIEE32 DEE32 HUKIV HBK5 RBK2 MK2
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_004974.4
Sequence length
11829.0 nt
GC content
0.4656

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3841.07 kcal/mol
Thermodynamic ensemble
Free energy: -4051.64 kcal/mol
Frequency: 0.0000
Diversity: 3327.50
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((.((((((...((((((((.......))))))))...))))))......(((((.(((.(((((.((((.....((((..(((........))).((((...))))..(((((...((((((.((......)).).)))))((((((((((((((.(((.(((....))))))))).((((...((((....((((...))))....))))..))))..))))))))))).)))))))))....)))).)))))..))))))))..((((((((((((....((((.(((.....))).))))((((((((((.(((((((((((.....(((((..((((((.(((..(((....))).))).))))))..)))))(((.(((((((.(((((...((((((.(.....).))))))..((((((.........))))))....(((((((((..((((((((.((((...(((((.((.....((((((((...))))))))..)).)))))...))))..)))).((((......((((((.((.((.((((((.((.(((...((((..(((....)))...)))).))).)).)))))).))))..))))))......)))))))).))))))))).((((((......)))))).((.....))))))).))))).)))))........).))))))...(((((.((((((((((((((((.....))))...((((((.(((((.((......))..))))).))))))...........)))))))).((((...(((((...(......)...))))).)))).(((((..((((......)))).))))).(((((.(((((((((((((((..((((((......)))((((..(((......)))..)))).(((((((........)))))))..(((((((..((((((((....((((((((((((((.(((((.((((((((.((((((....((((((((((.((((((......))))))...)))...((.((((((((((.((((...)))).)))))))).)).))..(((.((((((.(.((((.(((....((....))....))).))))).)))))).)))...))).))))))).))).))))))))..)))))....(((.((.(((.((((((.(((.(((((((((((((......))).))))))........(((....)))))))))))))...))).))).))..))))))))))..(((((((...))))))).((((.(((((......)))))...))))((((.....)))).))))))))))))))).)))))))........((((...))))..)))..)))).)))).(((((..((((((((((.(((((((....((((((....))))))....((((((....((((.((((((((......)))))(((..(((.(....))))..)))..((((.(((.((((.........))))))).))))....(((((((........))..)))))......((((((((.((((((..(((((((.(((............)))..)))))...))..)))))).)))))).))....)))...))))..)))))).....((((((((((.(((.((((((.(((..(((((((((((((.(((.....))).)))))(((..(((((((...((((((........((((((((.((((((((((((.....((((((((.(((.((((((((..((((((((....(((...((.((((((((......(((((((((((((((...((((((.((((((.(((((((((......((((....)))).....))))............))))))))).............(((((......))))).....((((......)))).((((((((..((((((((.(((((((((....(((((((.(((((((((............((((((.......))))))..((((.....))))((((((.....))))))..((((((((((...(((.((...((((....(((.((((....((.....(((..(((((.((((...((((.(((((((((..........)))))))))...((((((((((.((.((((((((.((.....((((.....))))..)).))).))))).)).)))))).))))...........))))...)))))))))..)))..))))))..)))((((((......))))))...(((((((((((((((((((((((((((.((((((((((.((((((((.(((((..(((((.........((((..(((((.......)))))...)))).....(((.....)))))))).((((((((..(.((((...(((((..((((((.((((...(((((...)))))................((((......))))))))...)))))))))))...........(((((((((....((((((((....))))))))((((.....))))...((((((((....))))))))(((((((.....(((((((((((((((((((....)))))....)))).......))).))))))).....))))))).))))))))))))).)....)))))))).......)))))...).))))))).))....)))))).)).)))........(((((((((((((((((.......((..((((((((((((((..............((((((((((((((...........................))))))))))))))............(((((.(((((....(((((.....(((((..((((...)))))))))(((((((((((((.....))).)))))))))).....................((((((........)))))).)))))))))))))))((((((((...)))))))).)))))))))..))))))).......)).)))))))))))....)))).....(((((......)))))...........)))))))))))(((((.....((((((((.................((((((......))))))...((((....))))...)))))))).....(((.((((((((((((.(((.....))).))).))))...(((((......)))))((((((((.((.((((.((..(((((((.....)))))))...)))))).)).)))))))).....(((((((....))))))).(((...))).))))).))))))))....)))))))..)))))).........((((((((..(.((((.((((..(((...)))..)))))))).)..)))...)))))(((((.((....((((.......((((((((((((((((((....)))))))))))))))))).......))))....)).))))).......(((((((....))))))).........(((((((((((...((((((((((((..((((((((((..((((........))))(((((((.........))))))).....)))))))))).)))))))))).))...))))..)).))))))))).....)).))).))))))))))....((((((.(((.(((...(((..((((((((((((.....))))))))).)))..))).))).))).))))))..(.((((((..(((((....)))))...)))))).)(((.....)))..))))))))).))))).)))))))..........)))).)))).))))...((((..(((((........((((((((....((.((((((((((.......((.((((((....)))..))).)).((((..(((((........((((((((.((((.(((.(((((((((.(((.(((.....))).))).)))..))))))))).))))...)))...))))))))))..))))..))))))))))))..))))))))))))).)))).......))))))))........)).)))))).......((((...))))..(((((((((.............((.((((.(((......))))))).)).....)))))))))(((((......)))))............)))))).)))).)))))((((((...((((((((((((((.(((((.......((.((((((((.((..((((((..(((((.((((.((((((....((..((((((...((..((((.(((((((......))))).)).))))..)).)))))).))...))))))...))))..)))))..)))))).)).)).)))).)).))(((((.(((...((((((((..((((((((((............))))))).)))..))))))))...))).))))).......(((((..((((((((.((((......((((((........)))))).......)))).)))))))))))))((((((........)))))))))))..))).)))))))))))....)))))).....((((((((...((.(((((......))))).))....(((..(((.(((((..(((..(((........)))..))).)))))))).))).............((((((..(((((..((((((...(((((...............................)))))....))))))......)))))..((((...((((.....))))...))))...........................................((((...))))....................))))))......((((....)))))))))))).((((.((........)).)))).............((((...........))))....))))))))))...)))......)))))......)))..)))))))).)))........))))))))...........(((....))).......))))))))((.(((....))).)).........((((((.((..((((.(((........)))...))))..))))))))))))...))))))))..........))))))....))))))).)))........))))))))(((((((((((..........((((((((((..(..((((((.(((((.(((......((((...((((........))))..)))).)))))).............)).))))))..)..))))))))))..))))).))))))))).))))))..)))((..(((((...)))))..))(((((((.(.((((..(((((((((((((.....((((.((((......(((....))).......((((((...))))))((((((((..(((((..............(((((((((((((((((..(....)..))))))))...(((..(((((((.((.(((......................))).)).)))))))))).......((((((((((((((((...((((((((.((((.........(((((....)))))........(((.(((((....(((((((.(((.............))))))))))..)))))))))))))))))))).))))).((((((((((......))))))))))........((.......))((.((((((((((.(((.((((((((((.((((((..(((.(((((..((.(((((...........)))))..((((((..((((((.....(((((((((.........((((((((.............(((((((((..............((((((((........))))))))...(((((..((((((((((..........))))))))))))))).(((.((((.(((.......(((((..........)))))...))).)))).)))))))))))))))))))).......(((..((((....))))..)))..(((((((((((((.........))))).)).))))))..(((.(((((((................))))))).))).................(.((((((((((((((((....))))))))..))))))))).....)))))))))......(((..((((.(((.((((((((((.......((((....(((((((..((((((((.((((....(((.(((((((((((.(((.((((((((((.((((((((...(((.....(((((((...((......((((((.....(((((((......)))))))))))))))...))))))))))))))).........))).))))))))))((((((((((((((((((((..(((((..(((((.......(((.((((((((.......((((((((((((((..((...((((((..(((....))).)))))).))..).))))))))..)))))...(((((..(((((...)))))..)))))....((((((((((((.(((......(((.((((......)))))))((((((.....................))))))...(((((((((...))))))))).(((((.((...........)))))))(((((.......)))))..))).)).))))))))))..))))))))))))))))..).))))..))))))))....(((.......)))..((((......(((((((...)))))))....))))..(((((((((((..((.((((((((((((.(((((((((((((((......))))(.((((((((((((.(((((((((((.....))))))))......)))))))))))............(((((((((((((((.((((.((((((..((((......(((((.((((.........)))).)))))(((((....(((((.(((((((...)).)))))))))).))))).((((..((((.....))))..))))(((....)))))))....)))))))))).)).((((((((....))))))))..........))))))))))))).....((((((((....))))))))...)))).).......))))))))...((((((((.(((.((((((((((....))))))....((((((.....)))))).((((((...))))))....))))))).))))))))((((((((((((((((.(((((((..(((((.((.(((((.((((((((((((..((((((......(((..((((..((((((...))))))..)))))))....)))))).........((((.(((.(((....)))....((((((......)))))).((....(((((((.....)))))))....))...(((((((((((((((.((....((((((((....)))(((....))).....((((((((.(.((((((((((..(((((((((((....((.((((.(..(((((((((((((...(..(((((((...))).))))..).))))))).))))))...).)))).)))))))))))).)..)))................((((..((((((((((((...)))))).............(((((.((...(((((((((..((..(((((((...(((..........((.((((((((((.((((.(((((...(((((.((.......))..))))).................)))))....))))...((((((((((.......((.......)).......)))).)))))).....((.(((((((.....))))))).))..)))))))))).)))))..))))))).)))))))))))...)))))))))))))..))))....((.((((.(((((((((.......(((......))).....)))))))....)).))))..))))))))).))))).)))))))))....)).))))).))))))))))........(((((((.(((((...................).)))))))))))((((..((((((((.((......)).)))))))).)))).(((((.(((....))).)))))..........))).))))..))))))))))))))))).)).))))))))))))...(((..((((....(((((((.....((((......(((((.((((......)))).)))))....))))......)))))))..))))..))).(((((...)))))(((((...))))).......))))).))))))).))))........)))))))...((((((((((.....((((((((.(((((((((..((.....))..)))).))))).......))))))))...)))))))))).)))))))).))..))))....(((((.......)))))...........)))))))....))))))))))))....(((((.((((.(((((((.((.((((....((..((((.(((..((.(((.....))).))))).))))..))..))))...)).))))))))))).)))))....((((((..(((((((.......)))))).)....((((..(((((((((((((.((((((((..((((((....((((((((((((((((.(((((((((....)))))))))))))))))))))))))...))).)))..))))).))).))))...)))))))))...)))).(((((((....)))))))......((..((.(((((((.....(((((....)))))))))))).))..))))))))))).))))))))))).)))...)))).))))))))..)))((((((((.((((((((((.(((((((((((.......))))....((((...((((((...(((((((((((((..(((((....)))))....)))))...))))))))..))))))...))))((((......)))).......)))))))((((.(((((((..(((((....)))))....(((......)))(((.((((.(((((.....))))).)))).)))......((((((((((................)).)))))))).((((.(((((((((((((.(......).))))))((((((((((.((.((((((((.............((((.....)))).(((((((((.(.((.....((((((.........))))))(((((((((((...((((((((((.......))))(((((((..(((((((((((...))))))).))))..(((((..((((((................))))))(((((..(((........)))..))))).))))).))))))).......)))).)).)))))))))))....)).)))))))))))))).)))).)).))))))))))..((((........))))(((((.(((((((((((((((((((((((..((.(((((((((((((.............)))))).....((((.(((((.(.((((((.((((((((..(((((((.(((..(..(((..............)))..)..))).))).)))).)))))))).)))))).).))))).))))..(((.((.....)).)))....((((((((((.(.......)))))))))))...))))))).))..))).........))))))))))......)))).)))))).)))))(((((..((....))..)))))..))))))).)))).........(((.((((((......(((((((...(((((....)))))))))))))))))).)))...........))))))).))))..(((((((...(....)...))))))))))).)))))).))))))))))))...)))))))))))))).))).))))))).....))))))..))))))..........))..))))).))).......)))))).))).....))))))).)).)..)))))))))).))............)))))..........))))))...)))))))))(((((((((((.....(.(((((.(((.....))).)))))).....)))))))))))((((((((.(((.(((((((..((((.((((.((((((.((.((..((((((((((((((..(((..((((.(((...))).))))(((((((..((((..((.........))....)))).)))))))((((((((((((((((.(((.......)))..)))...(((((..(((.(((((....)))))))))))))..))))))...))))))).....((((.((....))))))...)))....)))))))....))))))))).)).))))))((((((((((..((((......(((((((((..((((.((...((((((........)).))))..)).))))..))))).)))).......)))).(((((((....)))).))).)))).))))))...)))).)))).)).)))).).))).)))))))).....)))))..)))))))).......)))).))))(((((((((((((....))))))))))))).(((((((((((....))))))))))).(((((.((.((.(..(((...(((.((.......(((.((.((.((((((..((..(((((..........)))))..))..)))))).)).)).))).......)).))).)))..).)))).))))).....))))))....(((((.(((((..........))))).)))))..........)))))))....)))).).))))))).((.((((....)))).)).....))))))))))))))))).))))))..))))..)))))......)))))))..))))).)))).))))).)))).)))))).)))).))))))....(((((..(((((((((((((..((..(((....(((..((((((...((((((......)))))).......(((((.(((((((((((((....((((.((((((((..((......(((.......)))......))..)))))))))))))))))))))))))..)))))...(((((((.((.(((((....))))))).)))))))(((.(((((..((...(((.(((((......))))).)))..)).))))).)))....)))).))..)))....)))..)).)))))))))))))..)))))........))))))((((.(((((..(((((.....))))).))))).))))..........)))))..
Thermodynamic Ensemble Prediction
..(((((.({(((({{.,(((((.(((((.(..{((((((((.{{{|,....{(.{,(((((((.((((.(((..,({....(((....)))...)}))}))))}).))))),.,|}}}))).))))))))}...).))))).))))|(((((((((({((.(({{(((....))))))}}}.((((...((((....((({...})))....))))..})))..))))))))))|{|{{(|{{|,{{{{||||...|}}...((((((((((((((((,{.,.....((((.(((.....))).))))....{.((((((({,{{{(((({....,((((..((((((.(((..(((....))).))).))))))..))))))))){((((((.(((((.{(((...(((((((((.,.{|....|},|}))),,)))}))))}}.....(((((((((..((({{(((.((((,..(((((.((.....((((((((...))))))))..)).)))))...})))..}))}.((((......((((((.{(.((.((((((.,,.(((...((((..(((....)))...)))).))).},.)))))).))))..))))))......)))))))).))))))))).((((((......))))))|({.....))))))).))))).}}..........)),))))))),..,.}.)))).))).)))))))))........,,,((((((.(((({.({.,...,}}..}}}}}.))))}}.{{{{{,,{,{.|{||}}..||||.,.{,{{{,||{...,,,}}}.}}}}|,|||||(((,{..(((({.{,,,||||.||}|,.(((((.(((((((((((((((..(((,,,......}}}((((..(((......)))..)))).(((((((.,....}.)))))))..(((((((..((((((((....((((((((((((({.(((((.((((((((.(((,,,.({{((({{{{{{{.((((((......))))))..{|||,,.,{.{||{((({{{.{{{{,.{||||{||||||,,..,.))}}|||.{{{({|,|.((((.(((....((....))....))).))))}.}))))).)))...}}),)))})),.))).))))))))..)))))....(((.((.(((.((((({.(((.((({(((((((((......))).)))))},,,.....{{{...,)})}}}})))}},..,))).))).))..))),})))))..(((((((...))))))).((((.(((((......))))}...))))((((.....)))}.))))))))))))))).))))))).......{((({...}}}},})))..))))},))),(((((..((((((((((.(((((((....{(((((....)))))|.,..{({|{{.,..((((.{,.((({{.,....))))).,{{,(((,{,,.,|}||,,||,.,({((,(,,.((((.........)))))))}})))....(((((((.,......))..))))),,,,,,((((((((.((((((..((({((({(((............}},.})))),..,))..)))))).)))))).))..,,))},,.)))),,))))))...,.(((((((((({(((.((((((.(((..(((((((((((((.(((.....))).))))),{{..(((((((...((((((........((((((((.(((({(((((((.....((((((((.(((.((((((((..((((((((,,..(((...((.((((((((.....,{{{{.(((((((((,...(((((,.,({(((({,(({,(((,,....{{((....}))}....})))))}.....}}}}.)})))))||,.......,....|||||}}}}{{|||,,..,,,,.{{{{{{.{{{{{,({,{,((({.,,,})}},,..||..,,}}}}}.|}}}}}}|||}||||.....,}},,...((((((.......))))))..{(({.....|}}}..,,,,......|||||{{((,.((((((.{{{{{,{{{,.....{{..,,.,,{,,..||||,....(((.,(((({{((({.,.((((,(((((((((.,....,|..))))))))}{{,((((((((((.((.((((((((.((..,..((((.....))))..)}.))).))))).)).)))))).)))).,,,.......)))).,.)))))))))..}}}..,.|{{,,.{(,{(((((......))))))},.||||.|}}})})),}}}}}}||||,|||{,(((((...))))}..,.....,,{{{(((,({{......((((..(((((.......}))))...))))......((({,{{(((,,....(((((({,.,{{(((({...((((..((,(((((((((.(((.,....((((({,..,.....,{{{,{((((......)))))|||{{{,||{||,,||,.,........,{|||,||}},..}|||||,(({.{{{|||,,,|((((.....))))}..,|||||||}}..}}}}}}}}|.|||||..}}}|{{|(({,((.,,{({((({{{{{{{||.....,}},...,,{(((((((({{{(((({,,{{{(|{,,{{{({({((({.((((((((,.((((((({,.((((......)))).,}})))).(((((,,..{{{{((((..{{,(((((((((((((((((.......{{..((((((((((((((..{...........{(((((((((((((,|...............,,,,,,,,..)))))))))))))).....|,,...,((({{.{||{{....{{{{(,,,|.(((((..{{{{...,}}})))))((((((((({(((.....))).)))))))))),,...................((((((........)))))).))}}}}}))}))))){(((((({...}))))))}.)))))))))..)))))}}.......))}}}}}}))))))....)))).....{((((......)))))...........))),,,)))))})},,..,,,||(((((({{..,,{{...,,,.{{(((((({{{{{.,,,,||...((((....))))....)))))))}....})|}}||||(((((((.(((.....})},|||.||||...{((((......))))).,||||{|}||.((((.{(..(((((((,...,)))))))...}})))).}|,||||||(((({{{(((((((((.((((((({.({(...}}}(((.((((||||,.........,))..)))).)))..|||.{{((((((((..{.{{{{.{{{{,..||}},}),,,}))},}}}.}.,))}...}})),(((((.((....((((.......((((((((((((((((((....)))))))))))))))))).,.....)))).,.,}),)})}}.......}))))))).))))))))),......{{(((((((((((...((((((((((((..((((((((((,,((((.......,)))|(((((((.......,.))))))),,,},)))))))))).)))))))))).))...))))..)).))))))).,,,,})))))}}.}||||{..,,,..}}}}}.,,|||,{{{.,,(({|,{(((((((((((.....)))))))))},)}..,,}.))).))}.,{(((((....)))}}}.||||{....))))}...))))))}}}}..)))))))).))),))),)})},}}.}})))),.........,|||,.|||,.,,,,,.,{{{{..,{(((((,......,,(((((((((,,..,{(,,,,,............,||,...}))))}}))},))}|||,..((((({....}}}||,|{{{{.((((.(((.(((((((((.(((.{{(.....))}.))).)))..})))))))).))))..,))),..}}|}}}}}}}..||||..,|||},||||||,,,.{(({({({{,..)).)}}}}}}.)},))))),.......||.|,,,,|,,.....,|||...,}))}}|||{{{{,{...,,}.......((.((((.(((......))))))),)}...}})))))))))|||||},{{{{|||||...(((((((..(.....)..)))))))..((((({.....})))))..,,((((((...,,,(,{{.({((((((.((,.((((((..(((((.((((.((((((....{,..((((((...((..((((.(((((((......))))).)).))))..)).)))))).}}...))))))...))))..)))))..)))))).)),)).)))),)}.})))|,,}|||}}.,|||}}}}}}},((((((((............))))))),,}|,.((((({...})))))})))}|}})))}}}},)}.}||,|}||}||.......))|)))})).))).}),,...}}))..)))))}))))))),..,,,)})))))}}.....,,.(({......})),.},},,(((.(((.(((((((((((((({...})))....))))))))))).))).)))...,{(((...,,,...,..,}}.}}}},..,,........))).}))))||||....,,,..{(({.....)))).,,))),......}}}}}},,,,,}}}}}}}}}..................,,,,||||,..{(((.(((((....((((.....})))...))))).}))}....,.,............................................((((...)))){{{,......||,..........,}},.....{{((....))))...{({...((((.((........)).)))).))).........,,,,...........))}},,..})))))))))...)))......))))}.....,})}..)))))))).)))........)))))))}.......,,..{||....,}}....,..)))))))}((.(((....))).)).........((((((.((..((((.(({........)))...))))..))))))))))))...)))))))),.........))))))....))))))).}},........)))))))){((((((((((........,.((((((((((..{..((((((.((,...||...,,,.((((.{.((((........)))).,)))).}}||||.....}}......}).))))))..}..)))))))))).,))))).)))))}))).))))))..)))|(..(((((...)))))..)}{((((((.(.((((..((((((({{(({,...,{((((.{{{,......{((....))}.......((((((...))))))((((((((..(((((,{{{..........(((((((((((((((((..(....)..))))))))}.,(((..(((((((.((,(({....,,,,..,...........))}.,,.))))))),}}.,,,,..(((((({{{{{(((((...((((((({{((((...,..,..(((((....)))))........(((.({{{{....(((((({|{{,.............}}))))))))..}))))))))))))))))))),))),..((((((((((......))))))))))........{{....,,.||((.((((((((((,,({.((((((((((.,((((({{(({.(,((({{(,.(((.,.{{,{{{{{{.||,||,.,,,,{,,,|{{((({....,||||{{||}}}}}}}|||(((((.....,,.....,,.....)))))..............{((((((.,,.(({......)))..,,.)))))){(((((((((.{......}.)))))))))}..)))|||,}||||...}}))},.,((({{.{,......}))))}...|,{{{{{({.,.{{|...{(((((((.......))))))),,,||}.}}))))},..|,,(((((((({((((,........})))}.}}.})}}}}..{{(.(((((((......,.........))))))).))),|...,}}),,,.....{.((((((((((((((((....))))))))..))))))))}..,{{|||||||||,.{{.,(((,,((((.(((.((((((((((,......{(((....(((((((..((((((((.((((,...(((.(((((((((((.(({.((((((((((.((({{((({,,,,|,,..{(((((((...((......((((((.....(((((((......)))))))))))))))...)))))))).,||||,....,}}}.))}.))))))))))(((((((((({{((((((((..(((({..(((((.......(((.((((((({.......((((((((((((((..((...((((((..(((....))).)))))).))..).))))))))..}))))...{((((..(((((...)))))..)))))....((((((((((((.((((.....(((.((((......))))}))((((((..{{...{.......,,..,.)))))).,,,((((((((...))))))))),(((((,,,{..........,)))))){((((.......))))))}}}).)).)))))))))).,))))))))))))))))..).))))..))))))))....{{{,..,...)),..||,|...,,,.(((((({...||||,|{.,(((,(({....,,,((((..((.((((((((((((.{{{{((((({{((((......))))..{((((({(((((,{({((((((((.....))))))))...,,,))))))))))},........,|.(((((((((((((((.((((.((((((..((((......(((((.((((.........)))).)))))(({{,....{(((|{((((({{...}).)))))))))},|||||.((((..((({.....))))..)))}{||,,..}}}))))....)))))))))).)).((((((((....)))))))),{....},..))))))))))))).....((((((((....))))))))...,|||,,,,}}}}.}}}}))}}...{(((((((.{({.((({((((((....)))))).,{.((((((,...,))))))}|(((((...)))))}....}))),)),)})))))|((((((((((((((({.{((((({..(((((.{{.(((({.((((((((((({,,{(((((,,..,,(((..{{{{..{{{{((...))})))..)))))}}...,))}|||,|...,,,,({{{.|||||,|},,.}}|.,..({({({..,,,.}}}))),|{....((((({{.....}))))))....}},,.(((((((((((((((.((....((((({,,.,,,,,,(((....)))....,||((((((.(.(((((((({(..(((((((((((...,((.((((.{..(((((((((((((...(,{({(({{{..,})),)}},....))))))).))))))...).)))),)})))))))))),}..)}}................((((..((((((((((((...))))))............,(((((.({...{((((((({.,((,.((((({,,((({(((,.......,{.{(((((((((.((((,(((((...(((((.,{.......,}..))))).................)))))....))))...((((((((((.......((.......)).......))))},))))).....{{.(((((((.....))))))).)),.)))))))))).)))),})))))))),)))))))))))...},)))))))))))..))))....((.((({,(,(((((((.......(((......))).....))))))).,,.}},))}),.})))))))).)))))}}}|})))))....}}.))))).)))))))))).,......(((((({,((((,.{.................,.)))))))))))((((..((((((((.{,......,}.)))))))).)))).{(((({((,....))),))))}.........,))),))))..,}))))))))))})))).}}.)))))})))))|...(((..((|(,{,...|{{{|.,,..||||......(((((.,{((,,....)))).)))))....||||....,,))})))),.,))),.))).(((({...}))))(((((...)))))...,,..))))).))))))).)))),.,,,...)))))))..,((((((((((..,{,{,,(((((.(((((((((..((.....))..))))},))))..,,}}},,}}})))...)))))))))).)))))))).))..)))).......}}}..)))}))))))...}}))))},),))},....)))))))))))).,,.(({({.((((.(((((((.((.((((.,..((..((((.(((..((.(((.....))).))))).))))..)).,))))...)).))))))))))),||||}...}||||(({.{{(((((.......)))))}.}.,}}((((,.{((((((((((((.((({{{{(,,((((((....((((((((((((((((((((((((({....)))))))))))))))))))))))))...}},,))),,)))}}.))).))))...))))))))),,,),}}.(((((((....)))))))....,,((,..,,|||{{{{.....(((((....)))))})))))),.}}.)))))))}))).))))))))))).))).}.}))).))))))))..)))((((((((.(((((((((,.(((((((,,,,.......}}|}|,..((((...((((((...(((((((((((((..(((((....)))))....)))))...))))))))..))))))...))))((({.,....)))}.......)))))))((((.(((((((..(((((....)))))....,.{{{(((.,,,,,|,||||.{{{{(||||,|||}}.}}}},}}|,,,{{(({(((((({{.,,,......,,,,,,)),)))))}||,{||||||{{{{{{{{{{(,({{{{{,|,|}}}}}{{{{{{{{||.{|,||{{{{{,.....,{{,,,..,{{({,,,.}}},.{{{(((((({(,({.....{(((((.........)))))}{{{{{{{{{{,...{(((,,{{,{.|||,,.((({({(((....(((((((((({...|)))}||,,||}.{(((((.,{(((({,{,{|||,,,|||||..}}}}}||||{..||{........))),,})))).}}}))})),,)),,,)}))})}}}.}}.}}}}},,))))}}}}))}))||}}||||||||{||||.}}.}||||||}}}...((({{{{,,{(((((((,,,.||||||||,|||||||||||||...||,||||||||||||...},......))))))))),|{{,((((.(((((.(.((((((.((((((((..(((((((.(((..{..(((...........}..)))..}..))).))).)))).)))))))).)))))).).))))).)))).,,}|.,},...,))}))))}))|(((((((((.(.......))))))))))}..,||||||{{||..{{{.{{{{{..,||||||||||,.,,,{||||,|||}}}.}|||{(((((..((....))..))))),.})))|||.,||},}}....,}|||}||{{{{,|,},.||||{||}},,|||,.}}},)))))))))))})).))}}))),},.,,,,,}))))))).)))).{(((((((...{....}...))))))))))).)))))),)}))))))))))...)))))))))))))).))).)))}}}},,,,,}}}}}),,))}}}|{{{.......,))})}})),}))}.},,,,))))))}))))}}..))))))).}).)..}))))))))).))....,}}..}},}}}}}..........))))))...}))))))))(((((((((((.,...{.(((((.((({...}))).)))))}..,,,)))))))))))((((((((.(((.((((({{..((((.((((.((((((.((.({,{(({((((|{{{{|{,|{{({{|((({((,{(((((((,,|{{((((({{((.(,,(,.....{{,.|,,,,,||||,||||,||{{(((|{(((((({{(,(((,,,,,,.}}|..}||,..{{{((,.(({{(((((....))))))))}}))),,))))),..,)}))))).}}}}||||,,,...}))))),..,}..,,}})),)))),...))))))))).)).))))))(((({{{(,({{((((......(((((((((..(((({(,...(((({,,,.....,}},,})),.)},})}}..))))).)))).......)))).(((((((....)))).))).))),}))))))...}))),)))).}).)))).).))).))))))))..})))))))..)))))))).......})))}))}){((((((((((((....))))))))))))|{((((((((({....}))))))))))}.(((((.((.((.(..(((...(((.((.......,{,.((.((.((((((..((..(((((..{....,,.)))))..))..)))))).)).)).}}}.......)).))).)))..).)))).))))).....,|||||....(((((.(((((..........))))).))))).....,,,,,)))))))....)))).).))))))}.((.((((....)))).)).....))))))))))))))))).))))))..))))..)))))......,))))))..))))).}).})}},,})))))))))))),),))}),}))),}))|{{{{..{{{((((((((({..{{..,{{.,..({{..{({(({...{{{(((,,,..,}})))}..,....(((((.(((((((((((((....(({{{((((((((..((......(((.......)))......))..)))))))))))))))))))))))))..)))))...(((((((.(,{(((((....))))))).)))))))(((.(((((..,{,..(((.(((((......))))).))),,}..))))).)))....}})},}}..}})....}}}.,},.})))))))))))}..}}}}}.||||||||}}|||{{,,.,.,,...,,|||}}},,))))),}},,{{{{{,....,}))}.)))))..

Transcripts

ID Sequence Length GC content
AGCGCCAAGACUUCUGCAGGAGAGCCUCCGCUGGGCUUUCAAGUUGGCA… 1925 nt 0.5112
AUUCUGUGCUCCCUGCCGAGGAGAUGUGAGGGAUUUUCUCUUGGGGGAG… 11829 nt 0.4656
Summary

Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. The coding region of this gene is intronless, and the gene is clustered with genes KCNA3 and KCNA10 on chromosome 1. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the KCNA2 was significantly downregulated in injured dorsal root ganglia following spinal nerve ligation, a change validated by quantitative real-time PCR [Wu et al. DOI:10.1177/1744806916629048]. In rats, the KCNA2 was identified as commonly upregulated in the prefrontal cortex of the SHR/NCrl strain, an animal model of hyperactivity, compared to control strains [Dela Pena et al. DOI:10.1111/Gbb.12388].