| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACCCAGACAGAGCAUCGCGGCUUUGGCUGCAACAGGCGGUGGGCUCG… | 2476 nt | 0.5691 |
Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. It plays an essential role in T-cell proliferation and activation. This gene appears to be intronless and it is clustered together with KCNA2 and KCNA10 genes on chromosome 1. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the KCNA3 was identified as a differentially wired gene in the prefrontal cortex of animals selectively bred for high versus low voluntary methamphetamine intake, indicating its involvement in the transcriptomic basis of addiction risk [Hitzemann et al. DOI:10.3390/brainsci9070155].