Basic Information

Symbol
KCNA3
RNA class
mRNA
Alias
Potassium Voltage-Gated Channel Subfamily A Member 3 HPCN3 HLK3 RP11-284N8.3 Kv1.3 MK3 Potassium Voltage-Gated Channel, Shaker-Related Subfamily, Member 3 Voltage-Gated Potassium Channel Subunit Kv1.3 Voltage-Gated K(+) Channel HuKIII HGK5 Potassium Channel, Voltage Gated Shaker Related Subfamily A, Member 3 Voltage-Gated Potassium Channel Protein Kv1.3 Type N Potassium Channel Potassium Channel 3 Potassium Channel HUKIII PCN3
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_002232.5
Sequence length
2476.0 nt
GC content
0.5691

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-949.10 kcal/mol
Thermodynamic ensemble
Free energy: -992.68 kcal/mol
Frequency: 0.0000
Diversity: 493.03
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((...((((((......))))))((((......(((((((....((((.((((((((.((((((((...(((((((((...((((.((((((...((....)).)))).)).)))))))))))))((.((((.(.((......))).)))).)))))))))).))))))))))))..)))))))..(((.(((((((...(((((((((((.(((((((.((((.(..((((........))))...).)).))))))))).(((((((.((.(((.((.(((.(((..((((((.....((.((((((.(((....)))))))))))(((((((..(((((.(((((....)))))....(((((((((((((.((.......)))))))))))))))......(((((..((((.(((((((.....))))((((((((((.((((.(((..........((((((((...)).))))))))).))))...)))..)))))))....((((((((((....))).)))))))...((((((((.((...((...))...)))))))))).))).))))..)))))...)))))..)))))))...))))))..)))))).)).))).))...)).)))))(((......)))...........((((....))))...))))......))))))))))))))...))).((((((.((((.((.((((((((((((.(....).))))..)))))))))).)).)).))))))))))(((((((((((((.(((((((.((((((.(((.((((((((....))))))))...(((((.(((((((((((((((.......((((((..((........)).)))))).(((((((((((((.((((((.((.((.(......)))))..)))))).))))))...))..))))).)))..)))))))..(((((.((.....)).)))))((((.((((((...((........)))))))).)))).((((((.(.(((((......)))))).))))))((((((((((..(.....((...))......)..))))).......))))).....))))).)))))....................))).)))))))))).((((((...((((.(((..((.....)).))).))))..))))))....))))))))..))))))))..))))))..............((((.((.((.......)).)).))))...((.(((((((((.((((((.(((((((((...(((((((((((((.((((((((........(((((((.((....((((..(((.((....)).))).))))..)).)))))))...............(((((...)))))((((((((((((((((((((((...((....)).))))))((((((..((((..((.((((((((.........))))))..)).))..)))).))))))(((......)))....))))))).......(((((((..........)))))))......)))))))))...)))))))).)))))))))))))...)))....((((((.(((((..(((((.(((((((...((((..(((((.........)))))..))))(((((((.....)))))))...........)))))))))))).)).......))).)))))).((((((...........(((((.(((((((((.....)))...................(.(((((((((.(((.....(((((((....)))))))...)))))))))))).)((((((((....))))).)))))))))..)))))...(((((((...(((.............)))...))))))).....((.(((.(((....(((((((((.......)))))).)))..))).))).)).(((((......(((((((.(((((((((((.(((.((((((........))))))..)))...........((((((....(((((...((((.........)))))))))............((((..((.((.........)).)).)))).....)))))).............(((((((((...))))))))).....)))))).....))))).)))))))......)))))(((((............)))))....)))))))))))))))))).)))).((((((.(((((.(((...(((.....)))..))).)))).).))))))(((((.(((((....((((((((((.........)))))))))))))))...)))))..((((......))))....((((((...((((.((((.........)))).))))...))))))))))).)).
Thermodynamic Ensemble Prediction
.....{,{.{{({({.,.{{(((|||,||||,.{{{((((((((((.(((,,.((((((,({(((((((....(((((((((...((((.((((((...{{....}}.)))).)).))))))))))))){{.,((.{(((({{....,,...,,))))))))))})})))))))),)))}.)),))).))))))|((((((..,(((((((((((.(((((((.((((.(..((((........))))...).)).))))))))).(((((((,((.(((.(({(((.(((..((((((...{{((.((((((.(((....)))))))))))(((((((..(((((.(((((....)))))..(.(((((((((((((.((.......)))))))))))))))..,,..(((((..((((.(((((((.....))))((((((((((.((((.((,.........{(((((({{...,}.))))))))).))))...)))..)))))))..,.((((((((((....))),})))))),..((((((({{((...,{...})...)))))))))).))).))))..)))))...)))))..))))))),,.))))))..)))))),))}))).)).,.)),}))))(({......}}}....,......{(({...,)))}...))))......)))))))))))))|{((((((((((.,,((.(((({,{.(((({{(((((({(..(((((((((((..{(((..(,{((........))))..)))).)))))))))))....((((((({{((((((((....)))))))).}|,,...,|||,.{{(((((({,.......((((((..(,........)}.)))))).(((((((((((((.((((((.(,{((.{......}))))..)))))).))))))...))..))))),))),.}}))))))))))))})).))))))))))).,.}})))))))....)))))))))))|(((((,{({{,(,,,||.,.|||||}}}...|||||{{,,,,)))}}))..,|||}}}..}))),,,|||{{..,.{{|,|,...{(({.....,))}}}}}..,,|}||}..((({(({.{{{{{,,.{{...{((((((((({.((((((...((((.(((..((.....)).))).)))),.}))))).((((((((((..{.(((({{...{(({...,,((..,.....}}.)..}|}}}.,,)}..,)))).)..))))))))))..((((.((((((.(((({((((,{.(((((((((((((.((((((((.,{{....(((((((.((....((((..({(,((....,,.))),)))).,)).)))))))....}}}........(((((...)))))((((((((((((((((((((((,{.......}),))))))((((((..((((..((.((((((((.........))))))..)).))..)))).))))))(((......)))....))))))).......(((((((..........))))))).....})))))))))...)))))))).))))))))))))).,.}}},.{.((((((.((({{..((({({(((((((...((((..(((((.........)))))..)))}(((((((.....)))))))....,,,....)))))))))))).)).......)))})))))).|,{,..,,,,,,.....(((((.(((((((((.....)))...................{.(((((((({{(((.....(((((((....)))))))...)))))))))))).)((((((((....)))))},))))))))..)))))...(((((((...(((.............)))...)))))))........{||,|((....(((((((((.......)))))).)))..))}.))),}}.(((((......(((((((.(((((((((((.,.(.((((((........))))))..,,{{{,{{((,,,....,,({{{,((,,...{((,....,,,,..,,,|}},..,,{........}||,,..|,.,,........,))}),}),,,....,))))))},,.},.......(((((((((...))))))))).....)))))).....))))).)))))))......))))),{((((.(((.((((.....)))).))).))))))))))))))).))))...,.....,,,..,..}))))},)))))...,)})))}),}.)))))).(((((.((((({...,{((((((((.........)))))))))))))))...))))),{((((,.....|||.....,|||{{,,,||||.{|||||,,,,}).,)}}.))),...))))}},))}}....

Transcripts

ID Sequence Length GC content
AGACCCAGACAGAGCAUCGCGGCUUUGGCUGCAACAGGCGGUGGGCUCG… 2476 nt 0.5691
Summary

Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. It plays an essential role in T-cell proliferation and activation. This gene appears to be intronless and it is clustered together with KCNA2 and KCNA10 genes on chromosome 1. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the KCNA3 was identified as a differentially wired gene in the prefrontal cortex of animals selectively bred for high versus low voluntary methamphetamine intake, indicating its involvement in the transcriptomic basis of addiction risk [Hitzemann et al. DOI:10.3390/brainsci9070155].