Basic Information

Symbol
KCNA4
RNA class
mRNA
Alias
Potassium Voltage-Gated Channel Subfamily A Member 4 HPCN2 KCNA4L Kv1.4 PCN2 HK1 Voltage-Gated Potassium Channel Subunit Kv1.4 Voltage-Gated Potassium Channel HBK4 Voltage-Gated Potassium Channel HK1 Voltage-Gated K(+) Channel HuKII Potassium Voltage-Gated Channel, Shaker-Related Subfamily, Member 4-Like Potassium Channel, Voltage Gated Shaker Related Subfamily A, Member 4 Potassium Voltage-Gated Channel, Shaker-Related Subfamily, Member 4 Fetal Skeletal Muscle Potassium Channel Rapidly Inactivating Potassium Channel Shaker-Related Potassium Channel Kv1.4 Cardiac Potassium Channel Type A Potassium Channel Potassium Channel 2 MCIDDS HUKII KCNA8 HBK4
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_002233.4
Sequence length
4190.0 nt
GC content
0.4589

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1366.20 kcal/mol
Thermodynamic ensemble
Free energy: -1441.44 kcal/mol
Frequency: 0.0000
Diversity: 1123.62
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((....)))(((.(((((((((((..(((((....)))))..)))..((((((.(((((((.....((((.(((((((.(((((...............((.(((...((((......))))...))).))...))))).))))))).))))...))))))))).))))...(((((((.......(((((((.(((((......(((((...)))))......))))).)))))))..(((((.(((((((((((..((....))....)).)))))....)))))))))...)))))))))))).))))))..((....(((((((((((......(((((..((((((((..(((.......)))(((((((.(((((...))))).)))))))...............)))))...(((((((((((((.....(((..(((((.....)))))..))).((((((.((.........)).)))))).((((((..(((((...........)))))...)))))).((((((.(((((.(((((((((((((.((...((((.((....((((((..(..((((.(((....)))...))))..)..))))))...)))))).))..))))).......(((((.(((((((((((....(((.(((((((....(((..((((((.((..........((((..........)))))).))))))..)))......)))).))).))).....(((((..(.((((..((....))..)))).).)))))....((((.......)))).((((......)))))))))))))))....))))))).))))))...((((((((((((((.....(((((...................................((((((((((((...........))))))).))))).......(((((((((((((....)))).)))))))))..((((.............))))..((((((((((((((.(((...((((.((((((((((((.((((((((.(((..(((.....((((...(((......(((((((........))))))).....))).)))).....((...))...((((((.......)))))).)))..)))))))))))..))))))))))))........((((..((((((..((((((.....(((((((((..........)))))).))))))))))))...)))....)))).....(((....)))...(((.(((.(((....))).))))))))))..)))))))))..)))))))).((((((((((...)))))))))).......)))))..))))))))))))))(((..(((((((....)))))))..)))..(((.(.((((..((((.(.(((((.((.(((((..........))))).)).))))).).))))..).)))).)))...)))))))))))((((((.(((((((((.(((((((((((.((((..(((.((...((((..((((.((((.....)))).)))).)))).)).))).))))...))))))).))))...((((((((((((((....(((((((((((((((.((.......)).)))))))...((((....))))((((((((.((((..(((.....((.(((((((((.......)).))))))).))..(((((((....(((((((((.....((.((((((....)).)))).))...((((((..((((((........))))))..)))))).((((((.((.(((.(((((((((((((...(((..(((.(((.(((((.....((((((((((....(((((.........(((.(((((.(((......))))))))))).((((....)))).........((((((((((((.(((((((.....)))))))...))))))..)))))))).)))))))))))))(((((((.....(((((((((((..............)))))))))))))))))).............((((..((((...(((((((......)))))))..))))..))))(((((((((....(((((((..((((((((..(((.....(((.(((((.(((((.(((.((........)).).))..))))).)))))))).(((((((..((((...)))))))))))...((((((.(((((((......))))))).)))))).)))..)).))))))))))))).....))).)))))).))))).))).)))..))).))))))...))))))).))).))((((.((.....(((((.(((......))).))))).....)).))))....((((((...))).)))....)))))).............)))))))))(((((.(......)))))))))))))((((((((((((((((.((....)).))))))......))))))))))..........((((((((((.......))))............))))))..)))..))))..)))))))).(((.....))).(((..((........))..)))))))))))..))))))))))))))..((((.((((((.((((((.(((((...)))))..).))))).)))))).))))...((((...((((((((((...)))))..)))))))))..(((((......((((.((((.((((((((((((.(((.((((.((......)))))).......))).))))))))).)))...)))).))))...)))))))))))))).))...))))...((((((.......................))))))))))))))))))).....((((((.(((((...))).)).))))))..((((.((.(((((..(((((.(((((.(((((..(((((..((((((((((.(((((..((........)).))))).)).)))))))))))))..))))).))).)).)))))))))).)).))))..)))...)))))..((((((................)))))).....(((..(((.(((((((..(((......)))..)))))))..)))..)))(((.(((((....(((((((.........(((((.....))))).((((....))))..((((((..........))))))..((((((((.....((((((((((.......)))))))))).......)))))))).(((((......)))))....))))))).))))).)))...(((.....)))((((((.....((((((((..(((((.....)))))..)))).))))))))))(((((((((..((((((((.((((((((.....(.((((.((((.(((.((((((...............((((...(((((..(((((((((((((((((((...(((((..(((((((.((((...)))).(((((..((((((((..((.(((......(((((.....))))).....))).))))))))))..)))))((((((((.......))))))))...(((((((((((((((((................((((...)))).((((((((.((((..((((.((((((.(((.((((.....)))).))).))))))(((((((.....))))))).(((((((((.(((...))).))))))))).(..((((............))))..)....)))).))))))))))))..............(((((((((.......)))))))))...)))))))))))))))))))))))).))))).((((((((((((..((((.((((((..(((((....))))).))))))((((((...)))))))))).....)))).)))))))).........))))))))))))))))))).))))))))))))))).))))))))))).)))))))))))))......)))).....)))).))))))))))))))))...))...((((((...)))))).........
Thermodynamic Ensemble Prediction
...{((....}))(({,(((((((((((..(((((....)))))..)))..((((((.(((((((...,,((((.(((((((.((((({{,,,,,{{{,....{|,|||,.,||||....{{||||,..,,)}))}})))))).))))))).)))}.},))))))))).))))...(((((((.......(((((((.(((((......(((((...)))))......))))).)))))))..(((((.(((((((((((..((....))....))}}))))....)))))))))...)))))))))))).))))))..,,.,..(((((((((({......,(((({{{((((.,,((((((,,(((({{,(((((((.(((((...))))).)))))))......,{((((((,((((({..................}}}}}},||{{|,,,,.}}|||.,{,({{({(((.((,......,,}).)))))}.||((((..(((((.,,.....,,.)))))...)))}))}|||||,{(,,{(,((,,.,,,(((((.{{...((((,{{....((((((..(..((((.{,,....,}}...))))..)..))))))...}))))).}}..))))).......}},}},|}|||||}||}.}}}}}}.,,,,{{{{,||{,{,.((((((.((..........((((..........)))))).))))))..|||||||,,,|{((|{..,{(({{{,((,,,...}|,||}}||.....,..}|||.,.}}}})}}}}||||......,))))|((({,.....,}}},)))))),}}),,..)}}))))|}}||||,||{{(((((({{{{{{.....|||||,..................,,{{............,,,{,,,,,{{,...........,,}))))}))}})}...,..(((((((((((((....)))),,))))))))..{(((,,{{...,,||..|||}..((((((((((((((.(((...((((.((((((((((((.((((((((.(((..(((.....((((...(((......(((((((........))))))).,...))).)))).},..||...,,...((((((.......)))))).}))..)))))))))))..))))))))))))..,,,...,,||}}|(({({..((((((.....(((((((((,.......}.}))))).))))))))))))..,)|},,..}}}},.,..(((....)))...(((.(((.(((....))).))))))))))..))))))))}.,)))))))).((((({((((,..|})))))))).}}..,,)))))}}))))))))))))))||{.,((((((({...,,,,,},}},))}}}}|,,,.|}||||((({{.((((({.,.,,(((((((((.((..((((((((((((.({((((.((.((((.((((....,.,{.....,..}}.....)))).).))))))))).)).)))))))....))))).)).))))))))).|,||||,||{{||(..((.((((((((((((((((((.((((((.((((((((((((((((((({(((,((((((((.{,,,.{,((((((({(.((((.((({((((,.{(.,,||(({{{{((((((((,{{{{||{|{|{(|((((({((((,..(((({{||..,.},}}))),}}}},,,((({(((((({....})))}.,|),)))).,,....((({({((((..((((((........))))))..)))))))))....((({.{({((({((((({,.,...{.,...,,,,|,..})))).,}}}|||,,||||..,,|||||.||,|{{{{(((.(((((.{{{......}}})))))))).((((....))))..|||,..,((((((((((((.(((((((.....)))))))...))))))..)))))}|}.)))}}}}|}}},.(((((((.....(((((((((((..............)))))))))))))))))).............((((..{(((...(((((((......)))))))..)))),.)))),||||||||,},.|||||||}}||{{{||,,..}}}.,}}.|}}}.}}}}}}}}}.,,,,|}}}}}}}}.))||,||,.,||||{|||||||,.((((((,.,((((...))))))))))){,.((((((.(((((((......))))))).)))))),}},||||||||||||,|||||,,...,}|,|}}}}|||,},,.|,|||},,,}}}.}}}}})},}}}},,,))}}}}}}}}}|||},,)}}||||||{{|||,,,,,}},}}))})))))))))....,,,{{((({...))),,))...},})))).,..|{{{{...|||..,...{{||||.{,,,..{(((((((......((((((((((((((((.((....)).)))))).....})))))))))),((........}}}((((((.,....,)))))).......(((.(((((.({....))))))).)))..))))))))....{||||.,||,,..,,..)),.}}))))))))).)))))))))))))))))).))((((((((((((((,..{((((.(((({..((((({{{{{{((.,{({((..((((...((((((((((...)))))..)))))))))..))))}......((((.((((,((((((((((((.{((.((((.{(......)})))).......))}.))))))))).)))...)))).)))).....)}}}))))))).))))))))),...(((({{..,,,......,,{{{......,))))),.},,,,.)))},..,}}}((((((.(((({...})).)).)))))),.((((.((.(((((..(((((.(((((.(((((..(((((..((((((((((.(((((..((........)).))))).)).)))))))))))))..))))).))).)).)))))))))).)).))))..}))}}})))))}))}}.,,.,(((((..........)))))},...(((..(((.(((((((..(((......)))..)))))))..)))..))),,,.|||||}}..|((((({.......{{(((((.{,..||||{.,{{{....,,,...{{||||.....,,..,))))))..((((((((.....{(((((((({.......)))))))))).......)))))))).(((((......)))))....|)))))).)})))})).}}})).|,,..,,{{((((,,{{{(((,.,,||},|((({|...}))))}..,,.,,}},.,,,,,|({{{{((({,,{((||(((((((((((.,.,{.(.((((.((((.{((.((((((,,,.,,.........{{{,..{(((((..(({{(((((((((((((((..{(((((..(((((((.{(((...)))}.(((((..((((((((..((.(((......(((((.....))))).....))).))))))))))..)))))((((((((.......))))))))...(((((((((((((((((,,{,.,,,.,,,.,,.{{{{.,,|}||.((({{{{{.{{{|,,|{{{.{{{{{{.|,|,||||,,..,}}|{{{{{.|||||,{((((((.....))))))),|||,|||||},,..,{{||{|||||,|||.,..|||{||},.,}},,,,}|||{,,.,,.},,,.}}}))))}})))}}.....,,,..,.(((((((((.......)))))))))...}))))))))))))))))))))))).)))))}(((((((((((({{((((.{(((((..(((((....})))).)))))}((((((...))))))}||}|,...))))))))))))).........)))))))))))))))}})).))))))))))))))).))))))))))).})).))))))))))}....}})}.....}))).))))))))))))))))...},...{(((((...)))))),,,,.....

Transcripts

ID Sequence Length GC content
AGAGCGCGUUCGCGGCCAGGGGAGGCGUGUGCUGCUCCCGCAGCCAGCG… 4190 nt 0.4589
Summary

Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the A-type potassium current class, the members of which may be important in the regulation of the fast repolarizing phase of action potentials in heart and thus may influence the duration of cardiac action potential.[provided by RefSeq, Mar 2011]

Forensic Context

A study in mice demonstrated that the KCNA4 was upregulated in the hearts of cardiomyocyte-specific Mbnl1/Mbnl2 double knockout animals, which recapitulated myotonic dystrophy cardiac pathology and sudden death [Lee et al. DOI:10.1093/hmg/ddac108]. This upregulation was identified through RNA sequencing analysis as part of a broader gene expression signature associated with arrhythmia and dilated cardiomyopathy.