Basic Information
MANE select
Secondary Structure
Secondary structure that contributes a minimum of free energy.
Thermodynamic properties of the Boltzmann ensemble.
Structure Prediction
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGAGGGGCGGCUGAAGGUUGCAUCUGCUGGAAGGAGGCUUUUCGGCU… | 2910 nt | 0.5863 |
Summary
Potassium channels represent the most complex class of voltage-gated ino channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, the function of which could restore the resting membrane potential of beta cells after depolarization and thereby contribute to the regulation of insulin secretion. This gene is intronless, and the gene is clustered with genes KCNA1 and KCNA6 on chromosome 12. Defects in this gene are a cause of familial atrial fibrillation type 7 (ATFB7). [provided by RefSeq, May 2012]
Forensic Context
A study in humans demonstrated that transcriptomic profiling of left ventricular myocardium at autopsy identified the KCNA5 as a potassium channel gene up-regulated in arrhythmic sudden deaths compared to nonarrhythmic deaths, indicating its role in the acute vulnerable substrate for fatal arrhythmias through dysregulation of ion transport [Caudal et al. DOI:10.1016/j.jacep.2024.08.013]. A study in pigs demonstrated that the KCNA5 gene was uniquely upregulated in the biceps femoris and longissimus dorsi muscle of cold-exposed Bama pigs, indicating a shift to glucose utilization and glycolysis as a primary fuel source in cold environments [Yang et al. DOI:10.3390/ijms24087431].