Basic Information

Symbol
KCNB2
RNA class
mRNA
Alias
Potassium Voltage-Gated Channel Subfamily B Member 2 Kv2.2 Potassium Voltage-Gated Channel, Shab-Related Subfamily, Member 2 Voltage-Gated Potassium Channel Subunit Kv2.2 Potassium Channel, Voltage Gated Shab Related Subfamily B, Member 2 Delayed Rectifier Potassium Channel Protein Potassium Channel Kv2.2
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Drug abuse diagnoses

MANE select

Transcript ID
NM_004770.3
Sequence length
3748.0 nt
GC content
0.5240

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1274.50 kcal/mol
Thermodynamic ensemble
Free energy: -1342.30 kcal/mol
Frequency: 0.0000
Diversity: 1091.66
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((....(..(((((((.(((..((((((..((((((((((((.......))))....)))))))))))))).))))))))))..)......))))((((((((((......(((.....(((.(((((.((((((..((((((.(((((((((.(((((((((((((((((((((((((...))).))...)))).))))).......((((((((((((...(((....))).....))))))..(((((........)))))..................))))))...........))))))))))).))))).))))))).)))((((((..........))))))...((((......))))....((((((((((((..((((..(((((((((((((((.(((((((((.((.(((((......(((..((...))..)))))))).)).....))))))))).))...(((((((((((((.(.((..((((((((((((.......))))(((((((((.((((...((.(((....))).))((((((((.((.((((((.(((((((((....))))))(((....))).((((....(((((((.(.(.((..(((((((.(((((.(((((((((((((..(((..((((((.(((((...(((.((((...((((...((((...))))...)))).........(((.(((...(((((.(.((((.......)))).).)))))..))).)))(((((((((....((((((.....(((((....)))))..))))))...))))))).)).........((((((.....)))))).((((((((........(((.((.(((............((((.(((.....))).))))(((((.((((((.....))))))..)))))..((((((((((((.(((..(((.((((((((..(((.((((((((....(((.....)))...))).......)).)))))))))))))).)))..((((((((((((.(((((.(((...))).....(((((...)))))....((((((((.((((((...(((......((((....(((((((.(((((((.((((.((((((((...))).)))))..)))).)))))))....................((((.(((((((((((((((((.(.(((.(((((((((.((((..(((...((((....(((((.((((((((...((..((...((.(((......))).))....))..)).))))).))).)))........))..))))..))).)))).))).....))))))...))).)))))))))))).....((((..((.((((.((((...(((((...(((..((((((.(((..(((((.((((..(((((.((....)))))))..))))..)))))...))).))))((((((((.(...(((((.(((.(((......)))............((((((((..........(((((.((((((.(((......(((.(((((.........))))).))).(((((...((((.(((((((((((...(.(((((((((((((.(.((...)).).)))))))))...)))).)(((((.(.....((((((((.(((((((((((((.((((..((((...))))..))))...))...........)))))))))))...)))..)))))..).)))))........((((.(((..(((((((((((.......(((....((((((.((..(((((((((.(((((.(((..((...((((((((.(((((((((((.(((....))).)))))))..((((.(((((.........))))).)))).))))..)))))..)))))..))).))))).)))))......(((((((.........(((((......(((((((..(((((..........)))))....))))))))))))....))))))).(((((......))))).....)))))).))))))...))).......)))))))))))...))).))))..)))))))).)))))))...)))))))).)))))).)))))..((........))..(((((((.(((((......)))))......))))))))))))))).((((((((.(((.(((.......))).)))))))))))))).)))))..)))))))))............(((....)))....))..)))..))))))))).)))))).)))).((((......))))...(((.(((.............))).))).......))))))))))...))...))))).....))))....))))))))))).....)))))).....)))))))))))))))))..)))))))((((((((((((.((((((.(((((((((...(((((...(((.((..((.((.....)).))...)).)))))))).....))))))))).(((((((..(((..((((.((..((.((....)).))..))...))))..))).....)))))))(((.............))).......(((........))).(((((...((.(((((..((((....))))))))))).((.(((((((....))))).)).)).....))))).(((.(((....))).)))......)))))).)))))...)))))))............))))))))......))).)).)))........))))))))....)))))))..)))))............(((.((((....)))).)))...))))))..)))...))))))))))))).)))))..))..)).))).))).).)))))))))))........)))....)))))).((......)))).))))))))....))))))))))))).(((.(((((.((((.((.((((.((((....)))).)))).)).)))).((((...)))).))))).))).))))))))..)).)...)))...(((((((((...)))))))))(((((((((.......(((...)))........)))).)))))..)))))))).)))))..)))))))..)))))))...(((...((((..(((((..((......))..))))))))).)))..)))))))))))))))))).))).)))))..((((......))))....))).....)))).)))..(((.((((((((...))).)))))))).....(((((((((((.....(((((((((.((......)))))))..))))...........(((......)))......)))))))))))..((((((.......))))))....(((((..............(((((((..................)))))))...(((((((((((....((((((((............((((........)))).(((((..((((...))))..)))))))).)))))(((((((...........)))))))..............)))))))))))))))).............(.((((.....)))).)......................))).....
Thermodynamic Ensemble Prediction
{{{{.,,,(,,(((((({{(((..((((((..((((((((((((.......))))....)))))))))))))).)))))))))}..,......||||(({{{{{{{{......,{,.....{{{.((((({(({(((,.((((((.(((((((((.(((((((((((((((((((((({(,..,|}}.})..,}))).)))))......,(((((((((((({{{(((....||}.....)))}}||||||||,..,|,..)))}}......,,......|,.,}}|}}}.,........|))))))))))).))))).))))))}.)))|{((((....,,,...)))))},,,(({(,,,,..}})),}},{{((({{{((((.,{((|..(((((((((((((((,(((((((((.|||(({{{||...,||{,.{{,..,,,,))}))))}.}}...}.))))))))).))...{{((((((((,,|.,.{{..((((((((((((.......))))(((((((((.((((,,{{(,,,{,{,.}|||||,,{{{{||,||||((((({{.,{|||||,,..})|}}}(((,,..}}}.((((,,,,(((((((.{.(.((..(((((((.(((((.(((((((((((((..(((.,(((({{.(((((...(({{((((..,(((({..,,(({{{||||,,.||||.........((,(((((((((({,.({(((({{{{{{{|,,..|{||,||..|(((((((((((((((....((((((.....((({{....,)))}..))))))...))))))).,|{,.,..{((((((((.....)))))).))},{|||........,,,))))))))}..........((((.(((.....))).)))){((((.((((((.....))))))..})))}(((((.((({{((({...(((,(.((((((((.{((,.(((,((,,....(((.....}}}...}},...,}.))).})))),))))))))}}))}.((((((((.{,..,,{,,.(({...})),........,,.})))))))...}))))))).))))},},,|}}}.}}}}},,....(((((((.(((((((.((((.((((((((...))).)))))..)))).)))))))..............({{{...,{,{(((((.(((((((.(((.,..,(((..((((.,.,({{,.,{.{{........,}||{{,{(((({{{...{{,.{{...((.(((,....,}||,||....}}..}}.}))}},|||,}}}..,.|,|}||||||,{{((((.,,,,,(((({{(((,,(((({((,{,((((,{((({{{,,,,.{((((.((((((((((...{((..(....((((((..,(((((((((..,{,,.....{{((({((,...}}|))}}||{{{.(((((....))))).)))}|({{{{{.{{..{{..{{(...,,........))}}}.,,..}}}}))...,,,,..)))))))))..{{{,(((......))))}}...,((((.........)))))..))))))...)..))).))))))))))....(.(((((((((((((.{.(,...,}.).))))))))}..})))).){((((,(,,,{,((((((((.(((((((((((,,.((((..((((...))))..))))...,,..........,)))))))))))...)))..)))))..}.||||}..,.{,,,{{{{,{({..((((((((({{,,....,|{{.,,,{|{({{.{{..(({{(((((.(((((.(((..{,...{(((((((.(({((((((((.(((....))).)))))))}.((((.(((((.........))))).)))}.))))..)))))..}}}),..))).))))).)))))......{{{{{{{.|||,....{{{{{,,....{{{{{{,},|||||...,}},}},),,,,....)))}))))))))....,))})))|(((((.,....}}}}|...,,||||||.}}}})),}}))).,,..,,}}}))))}))),,,))),))})}})}},,,,},}}}.,))})))}}}}}},.|||{((.((((((...........))))))}}))}.((({{.,,..,})))}..||}},)))))}}((((((.((((((((..((({((......((((.....(((((((...,..{{...{((....)))},.,...))))))).....))))..))),.)}....))))))))...)))))){((((((.,{{...,,|,.,||{|||}|}||.,}}}}}}},..,,,,,,}}}}}.,|||{|,{{{{..,{,....{{|{..{{|.,,....,,|}...,)))..)))),.,.}}..,..)))),)))..})},,}..||}|||{((((((((,,,,.,,(((((,(((,,,,,.}}}.}})}}}}}}}}}}}||...}|}}.)))))},.}}.|{{|{|,,...}))))),))))}|,||||,,.|.|,,,|,|,|,}}|,}}}}..})).,,.))).))))))).))).))).}...)))}.........)})))))))))}...,|||.....,)})))}))),|}..{(.(((((..((((....)))))))))}).({,(,{{{||}},,})))).))}))}}},.},}}|,(((.{{,...,))).}}},,,|,,|,|.||{||},,,,||||{((({.,..,}}}}..,)))}}))}.....)))}).,,},}}}....,}}))))))....)))))))..)))))............(((.((((....)))).)))...}}}))),,))).,.))))))))))))).)))))..))..))},)).))).).)))))))}})),.,..,,|}},....}}}})}.}}......)},,.,}}}}}},.,..))}}))))))))).(((.(((((.((((,((.((((.((((....)))).)))).)).}}||.,,,|,,.)))))))))).))}.))))))))..}}.|...}}}},.(((((((((...))))))))){((((((((,,{,...,,,...,}}}},.....}}}}.}))))..)))))))).)))))..))))))),.}))})))}|.(((...((({..(((((..((......))..))))))))).))).,}}}}}}}}}}}))))))).)})})))||,,{{((......)))),,,,}}},....)))).}}}..(((.((((((({...))).)))))))).....(((((((((((.....(((((((((.((,.....)))))))..))))........,.,(((......))),.,...}}}))))))))..((((((.......))))))....((((({,...,........(((((({..................))))))).....,{(((((({....{(((({{{|...........{(((,.....,,))}}..,,,{{{((({...}}}}.,)))))))),))))|(((((((.........,.))))))),.............)))))))))))))))).............{.((((.....)))).}...........,,}}.,,...,)),.....

Transcripts

ID Sequence Length GC content
GCAGCCCUGUGUGCGCGCCGGGCCGGCUAGCUGCGGGGCGGGGGAGCGG… 3748 nt 0.5240
Summary

Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the KCNB2 was significantly downregulated in injured dorsal root ganglia following spinal nerve ligation, with a 0.10-fold change compared to sham controls [Wu et al. DOI:10.1177/1744806916629048]. In a separate investigation of alcohol dependence in mice, the KCNB2 was identified as a potassium channel gene highly expressed in oligodendrocytes at lower pseudotime values [Salem et al. DOI:10.1016/J.Nbd.2023.106361].