Basic Information

Symbol
KCND2
RNA class
mRNA
Alias
Potassium Voltage-Gated Channel Subfamily D Member 2 KIAA1044 Kv4.2 RK5 Voltage-Gated Potassium Channel Subunit Kv4.2 A-Type Voltage-Gated Potassium Channel KCND2 Potassium Channel, Voltage Gated Shal Related Subfamily D, Member 2 Potassium Voltage-Gated Channel, Shal-Related Subfamily, Member 2 Voltage-Sensitive Potassium Channel
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_012281.3
Sequence length
5830.0 nt
GC content
0.4525

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1785.40 kcal/mol
Thermodynamic ensemble
Free energy: -1891.21 kcal/mol
Frequency: 0.0000
Diversity: 1659.98
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((.((...(((((((((((.(.(((((((..((((((((((((((.(((.(((.(((((((((.((((((((((((.((.(((((.(.(((((.....(((......))).......)).)))..).))))).))))))))))))((((((((...........))))))))......(((.(.((((....)))).).)))..((((..((((((((.((.(((((((.((((((((((((((((((((..((((...(((.(((((((.....)))..((((....)))).(((((.((((.((((((((.(((....((((((((((((.(((((((..(((((((((((((.(.(((.((.((...))..))..))).).))..)))))))))))....)).))))))))).))))))))..(((((((((((.((((((((((((..(((((..((((((((.((...)).)))).))))..)))).)..))))))).).)))).))).)))))))).(((((.((...(((.(((((...))))).)))......)))))))..))).))).))))).)...))).))))).)))).)))..))))((((.(((((...))))).))))...)))))))).))))))((((((..(.((..(((.......)))..)).)..)))))).((((.......))))...)))))).)))))))...))....((((((.((((((((((.((((..(((((((((..(..(((....)))..)..)))))).)))......(((((((((.((((((((.(((((.((((((.(.(((((....((..(((((.((((...(((((..........))))))))).)))))..))....)))))).)))......(((((..((((((((((((....(((((((((..((((((.......(((..(((.((...(((((...((((((((((..((((((.((((((...((....)).....)))))).))))))....)).....)))))))).)))))..)).)))...)))........(((((.(((.....((....)).....)))..))))).......((((((.(((.((.((........)))).))))))))))))))).))))).((((((....((.(((((((((((((((((((....((((((((..((((((.(...........).)))))).))))))))(((((((((...((((((.((((((((((((((.((((((......))))))....)))))))((((((((..(((.................((((((((.(((((((((.(((((((....(((..((.(((((...))))).))..)))..)))))))..))))).))))..))))))))...)))...)))))))).((((((.(((((((((...))))))))).))..(((((.(((.(((.((((((....))))...)).))))))))))).(((((((((.................))))).))))))))..((.((((((...)))))).))(((((..((((....))))..))))).(((((........)))))))))))).)))))))))))))))..)))))......)))))))...............))))))).))))))))(((...((((((((.......((..((((((((................(.((((.((((((((....(((((.((((.((((......))))...(((((........))).)).((((((....((((((((((((...(((((((...(.....)...)))))))(((((((.((((...(((.....(((((.(((((((((((((...........))))))).((((((((...))))))))(((((((((.(((((((..(....)..))))))).............)))))))))((((.((((((((((((((((....))))))((..(((.((((((....((((((..((((((((.......(((((.((....)).)))))....))))))))......)))))).)))))))))..))..............((((((((((((((((.((((((((((..(((((((...((.((((.(((((((.(.(((((.(.....(((.(((((((((((...((((.........)))).((((((((.((((...((((((.....(((((...........))))).))))))...)))))))(((...........))).(((........)))..((.((..((((((((((.(((....)))))))))))))...)).)).....((.......)))))))))))))))))).....)))....).)))))).))))))).)))).)).....)))))))...)))(((((((.(((((((.......((((..(((((.((((((((..(........)..))))))))))))))))).........)))))))(((........)))........)))).)))((((((((((((.((((((.(((((((..(((((((..........))))))).(((......)))......))))))......).))))))................))))))))))))..)))))))...)))))...)))))))))))...))))))...))))))))(.((((...)))).)..((((.(((((...)))))..)))))))))).))))).....))).((((((..(((.....((((........)))))))..).))))).....((((((((.....)))))))).......((.((((....))))))(((.......)))..))))...))))))).......((((.....((((((..(((((....(((((((.((((....))))...(((((((((.(((((.(((....(((((((....((((((((.(((((..(((.....)))........((.((((((...((((((((.((((.((((.......)))).)))))))....(((.(((.((((((((((((.........).)))).)))))))...(((((.(((......)))...))))).....................((((................))))..))).)))..)))))..)))))).))(((((((((((.(((((((((((((((.((((((...((((((((((((((.((..((....)).)).)))..(((((.............)))))...((((((((.............(((((......))))).........((((((((.(((..........))).))))))))......(((........))).....((((((((..(((((......))))).((((((((...))))))))...........(((((......))))).)))))))).....(((((..........)))))...))))))))...........((((.......)))).......)))))))))))..)))))).)...........))))...)))))))))).)))))))))))......)).)))))))))))(((..(((((((....(((((.((((.......((((..........(((((((..(((.((...)).))))))))))((((..((....))..))))))))......))))..))))).)))))))..)))..(((((.(((.....(((((((((((((((......(((((((((((....((((((....))).))).....))))).)))))).....)))))))).....))))))).))).)))))))))))).....))).....((((((.....((((((.........)))))).....))))))..(((.(((.(((.(((((((((((((...))))))).....)))))).)))..)))))).))))).))))))))).(((.((..(((......)))..)).))).(((((((...(((((....))))))))))))..((((((.((............))))))))..((.((((.(((((((.......)))))))..)))).)).)).)))))))))).))))))......))))))))))))))))))))))((........)))))).)))))........((((((........))))))...(((((....((((((...........................))))))...)))))((((((((((.................)))).(((((.((......((((((((....(((....((((((((((((....((((...))))(((((....))))).))))))))))))....))).)))).))))......)).)))))..(((((((((....(..((((((..........))).....)))..).....)))))))))...((....))))))))....)))))))).)))).).(((((((..((((......))))..))))))))))))))).)).)))))))).)))....))))....)))))))))))).)))))))))))))))))......((((((.........))))))..))))..))))).)))).((((..(((.((((((.....(((((((((.......)))))))))...............(((((....)))))...(((((................)))))...((.(((((((.....(((((..((.......))..)))))))))))).))...)))))).)))...)))).)))).)).))))))))..((.(((((............(((((((.....)))))))....(((....)))...............(((((((.........(((((((.((((((((....))))))))..((((...)))).(((((.....)))))......((((.......))))(((((........)))))..)))))))..)))))))......(((((...((((...)))).)))))........((((....(((((........))))).....))))))))).))......(((((...))))).((((...(((((...(((((((.((((((.(((....(((((((.....))))...))).......((((((((..........))))))))....(((((((......))))))).................)))..)))))).)))))))..)))))...))))..)))))).....((((((...((((((((.((((((...(((((...)))))..))))))..........((((........)))))))))))))))))).......))))))))))))...............)).)))).)))))))).)))..))))).)).......(((((((((((...)))).)))))))(.((((((((((((...)))))).((.((((((((...........)))))))).))(((((((((......)))))))))..........)))))).))))))))..)))))))..).)))))))))))...)).).))...
Thermodynamic Ensemble Prediction
....,,(((.{{.,,{((((((((((.{.(((((((..(({,((((((,,{,.,,,.{{,.((((({(((.{(((((((((((.((.(((((.{.(((((.....(((......))),......)).))).,.}))))).))))))))))))|(((((((.,,.,,..,,.}}}|||}}..,.{|({{,{.(((({{..||||,|,|||.,((((,{((({,((({((,(((((((.((((((((((((((((((((..(((({,,(((.((((((({{{,,||},.{{((|...||||{(({((.{{{..{{{{|{||.||{.{{,((((((((((((.(((((((..(((((((((((,,.{.,((.((.((...}}..))..))),..)),.)))))))))))....)).))))))))).))))))))..{((((((((((.((((((((((((..(((((..((((((((.({...)).)))).))))..)))).)..))))))).)))))).))).)))))))}.(((((.((...(((.(((((...))))).)))......)))))))}.))}.)))}))))).,...}}}.))))).)))),}|}..||||{{{{.{((({...))))).))))...)))))))).))))))((((((..{.((..(((.......)))..)).,..)))))).((((.......))))...)))))).)))))))...|,..,,{(((((.{{,(((({{{||((({{(((((((((.,(..{,,....,}}..}..))))))},)).....}||||{|{{{,|||{,{,|}||||||,{{(((.(.(((((..,.((..(((((.((((...(((({..,.....,.})))))))).)))))..)).,..)))))}.))).....,(((((,.({{((((((({,{((((({((((((,.{(({{,.{(((,.,((..(((.{{...(((((,,,(((({(((,{..((((((.((((((...((....)).....)))))).))))))....,,,},,}))}}))}}.))}}},,||.}||,.}}}}......,}},,.,},}}},}}}|}}...}}}}},,,}}}}||}||..,||||({{{((,(((.{(,((......,.)}}),}||}}}}|||||||}.,||}},},..,,|,.,{|||||||||{{{{,{{((((((({,,.{{((((..,,{,...{||||.|,..|||||,.,,...,((((((((((.......,)))))})))}.,(((((((((.((((((......))))))....})))))))),}}}})}.,}}}}}}}}}},...,....((((((((.{((((((((.(((((((....(((..((.(((((...))))).))..)))..)))))))..)))))}})))..)))))))),,..|||||||{{||||{,.,,{{.(((((((({...})))))))).))...{((((||..,}|{},,|||{{||||||...,,,)))..,}}})))))})}}}{(((((((,.((,......,(((((..{.((((..{(.((((((...)))))).)}(((((..((((....))))..))))).(((((........))))))))).|)))))))}.)))))))).})}}}),||.,,,,.(((((...(((((((..((((((..,......(((({,((..{(((..(((((((((((.{(((,...|}},.....((((...}}}}.(({....})}...{(((((,{,...((({,,,,,,,|||{{|{(({{{...{{,{({(,.,{{||||,..|})|,,,,.,..}},},|{||||{,,,|,,.}})..|}|}}}|||{||||..|(({...}}}...,}})|||||.,,}}(((((((.,.....}...))))))).((((((({...})))))))(((((((((,(((((((..(....)..))))))).............))))))))),...}}}})}})),))}))),,..)))))))))))))).)..)))))))......,..)))))).)))))))))))).(((((((((.{{{,({((,{,({((...,,,.....))},},)))},))}}..,,.))))))))).{(((((((((((((((.(((((((,{{,.(((((((...((.((((.(((((((.{.(((((,(,....,((.((((((((((,...((((.........)))),((((((((.((((...((((((.,,..(((((...........))))),))))))...))))))}(((...........))).(((........)))..((.((..((((((((((.(((....)))))))))))))...}).)).....|{.......)}))))))))))))))))..,,.,,}.,},..))))),.))))))).)))).)).....))))))),..}},(((((((.(((((((.,..,,.((((..(((((.(((((((({.(........}.}))))))))))))))))).,,..,...)))))))(((,.......,},,,,,....)))).)))((((((((((((.((((({.,{(((((.{(((((((..........))))))).{{{...,,,})),.....))))))......,.}}|||,.........,}}....))))))))))))..)))))))...)))))...))))))))))},,(((.(((,({{{...,.,)}}}.}}},|||.,,,((((..{{..((((((...((((.((..((((....)))).)).))))...)))))).,,.)))).}||||.||))}}..,{{|}}{{||,,...((((((((.....)))))))).{{..{{{{.,,{{{{.|||||{|{{.|||||{,,||||}.{{..,.}|||||,{{||},||{{.,}}}|||(({,.(({{,...,||||{|{.((((....))))...,{{{{{{{{.{{{{{.,{{....(({((({..{{((,,,,||}|,,|||.{|{,,.,,|||.,,.,,,.,|,|||||||,|||.||,{,|{||{,|||||||},,.,,}}|)))|}}|||{||,|,,|||,,{{{,.,|||||,..||||,|,|{{{{{{..,{,...{{{{{.|{{.,,,,.}}}...,}}}|,.......,||,,,,,.....{((({{{..,{{{{{{{{,,|||{{({{{{{{{.....((((((((....))))).))}..,,{{{|((((((,,,,|}||||,..,,|||||||{,,,,{{|||{,(({..,||.{{{||,.}||{||,...,..|||,..|,}}},,{{{{{,,,..............(((((......))))).,.......((((((((.(((..........))).)))))))}..{{.,(({.......,}}),...|((((((((..(((((......))))).{(((((({...}))))))}...........{((((......))))}.))))))))},,,.{|{{{.},,,....}))}))...}))}}}}}............,,,.......}}}{{{{,...})))),,|||,..,},,.},}......{{{{.((((((.(((({...))))).))))))))}}...,{{{{||||||||,((((..(((((((....{{{{{,{,.........,,,....,||....})),.,({{..((((((((.{{{{{..|||.((((.,{{...,}}..))))))))}....))))))))..))})))))))..)))).||{{,..,...,,.,{{{(((((((((({..,||,|({((((((((....,{{|||,,,,})),)))..,,,))))),)}}}}}.,...))}})))),,,,,)))})})}}},.}}}}))))))))|..,,||,....,||{{((.....((((((.........)))))).....)))))}..(((.(((.(((.(((((((((((({...})))))).....)))))).)))..)))))).}})))}))))))))).(({.((..(((......)))..)).})).{(((({{,..|{{{{...,)))))))))))}..((((({.({,.,....,,,,|}|}}}}}}..{(,((((.(((((((.......)))))))..)))}.}},,}.},||||||||.,||||,,{...,||||{|}||.......{{{{..,,....,.,,||||{{.{{,,...{{{{{,((((((........)))))}..,|{|||....{{||{{}}|}},}},},........,,......}}))))},,})),)|||....}|}}||}...,{{,||,{,...||,,|||{{,,.......,,{{,{{,.,,{{{,}|}|||{{,|||||.,,}}||||...}))){{{{{...,}))))}}}}}}}))))))},.})))}|,{,.,,,,.}}||||||,{,,,,,(((((({{({,...,,|||(((..,.......}||.|||||{{{{|,.,,,|||||||}}...,,....))}}}))))))}|||,,}}),,})))))}{((({{..{{||,.....,))),.}}}||,((((((((..........))))))))}).,,......}))})))}}))),))))))))))})}}))).,....{(((((.........)))))}.,)))}..)))}),))},.,|||,,||{}|||{{,{((({(((((((((.......)))))))))..})))}........(((({....)))))...(((((...,,,.....,}},.)))))...{{.{(((((({((((.{{,{.,(......}}}...,))))))))))}.}},,,|}}}}}.}}}..,}))),,..},}}})))}}})),}||}|||||,,..,,,.....(((((((.....)))))))...}||.,,,,))).....}}}}}}}|}.(((((((......,..(((((((.((((((((....))))))))..((((...)))).{{(((....,}}}}}.....,{{{{,,|,...}}}}|{{{{........}}}},..))))))),,)))))))......(((((...(((,...}})).))))).}}}}}}}||||}...(((((........))))).....}|||||||,,|}{{,...{(({,,,,||}},.,{||,,,{{|{|.,.{|{|||{,|||{{{.,{{....(((((((.....))))...})).......{(((((((.......,..))))))))....(((((((......))))))),,,,,,...........,}}||}}}}||,|}}}}||,{,}}}}..,))),..,))))}...,,,|,{{{...,{{{{{{..((((((...{(({{...}))))..)))))),,}},....,{{{|,,,,,...))}})}))|}}}},,,,},,.,,,.}}))})))))))..,,}.,,,,}}.,,)),)))).,)))),||||||{.|||}}.{{{{{{....||||||,,{,},},)))})))},,,..(((((({{((((,,,,}}}},.((.((((((((...........)))))))).))(((((((((......)))))))))...,,,,,,.)))))}.))))))}}..)))))))..).))))))))))}...)).).,,...

Transcripts

ID Sequence Length GC content
CUAACCUGCGUGGCGGGGCGUGCGCGCGGUUAUUUAUUUAUUUUCUCCU… 5830 nt 0.4525
Summary

Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the KCND2 is highly expressed at lower pseudotime values in oligodendrocytes within the medial prefrontal cortex of alcohol-dependent subjects [Salem et al. DOI:10.1016/J.Nbd.2023.106361].