Basic Information

Symbol
KCNE3
RNA class
mRNA
Alias
Potassium Voltage-Gated Channel Subfamily E Regulatory Subunit 3 MiRP2 HOKPP Potassium Channel, Voltage Gated Subfamily E Regulatory Beta Subunit 3 Potassium Voltage-Gated Channel, Isk-Related Family, Member 3 Potassium Voltage-Gated Channel Subfamily E Member 3 Minimum Potassium Ion Channel-Related Peptide 2 Potassium Channel Subunit Beta MiRP2 MinK-Related Peptide 2 Cardiac Voltage-Gated Potassium Channel Accessory Subunit Voltage-Gated K+ Channel Subunit MIRP2 BRGDA6 HYPP
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Time since deposition estimation

MANE select

Transcript ID
NM_005472.5
Sequence length
3064.0 nt
GC content
0.4716

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1158.10 kcal/mol
Thermodynamic ensemble
Free energy: -1211.46 kcal/mol
Frequency: 0.0000
Diversity: 660.32
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...........(((.((((((.(((((((((..((((((((((..(((((((((.(......(((((((...((((.((.(.(((..(((((.....))))).((.((.(((((((((....((((...))))....))))))).)).)).)).(((((....)))))....((..(((....)))..)).((((((((((((((..(.(((..(((((.(((((((((((((...((((.(((....))).))))..))))((((((((((..(((((.(((((((..........((((.((((((((....(((((.(((((((((.((.(((((.(..(((......)))..).))))).))..((((((.(((((((((((...))))...)))))))..))))))(((((..((((...(((.((((((((((........))))))...)))))))...).)))..)))))...((((((.....))))))((((((((..((((((((((.(((.......))))))))........(((((........)))))(.(((..((((...(((.((((.((((...))))...))))..)))...))))..))).).........((((((((.(((.((((((.(((.((.(((((((((((((((..((.((((((...((((((.((.(....).)).))))))...)))....))).)).))))..)))))))...)))).))))).))))))...))).))))))))..)))))))))))))))))))))).))))).(((((((....))..)))))(((..((((((((((((((....))))))))...))))))..))))))))))).)).))(((((((((....................(((((.....)))))..((((((.((((((..((((((((((((..((((((((((..((....(((((((.((((....(((.((......)))))(((((((((((.....)))))...))))))....(((((((((.((..........((((((...)))))).................(((((..(((..(.....)..))).))))).(((((((((.((((....))))..))))))))).......(((..((((.....))))..))).....)).)))))))))...)))).))))))).(((((((..(((((.(((((.(((((((((.....((((.((((.....((((......))))......................................((.((((....)))).)).)))))))).......((((((((..((((((.(((.(.(((..(((.......))).)))).))).)))))).(((((((.........)))))))((...((((((.((((.(..((((.((((...))))..((((((...(((((............(((((.(((((....)))))(((((((.((.....((((((...........(((.(((((((((((((((((((..((.((((((((((((((.(((((((.......(((((((((.(((((((((.(((((((((((((((((((((((.(((((((((((((.(((((((((((((((.(((.(((.((((((((((......((((((((((((((((((....))))))))))...((((((....(((((((((((((((.((((((((((((((((((((((.(((((.((.((((((((((((((((.(((((......)))))((((....))))..((.((.(((.(((.((((.....)))).)))))).)).)).(((.((((....))).).)))...)))))))))))))))).)).))))).)))))))))))))))))))))).)))))).)))))))))..))))))............))))))))......)))))))))).))).))).))))))))))))))).))))))))))))).))))))))))))))))))))))).))))))))).))))))))).......))))))).)))))))))))))).))..))))..))))))))))))))).)))...........)))))))).))))))).............(((((((...........)))))))))))))))))..)))))).)).))..).))))..))))))...))....))))))))..))))))))))))))))))))))))))....))..))))))))))..))).....((((...((((.((((.(((((...)))))...)))).)))).)))))))))))))..))))......)).))))))..........))))))))).((((......(((((((.(((((((((((..........((((((...((((...))))))))))((((..(....)..))))))))))))....))))))))))..))))))))))))))))....)).)))))))).....(((((((.......))))))).((((((((((..(((((.(((((....((((((..(((....)))..)).))))....)).)))))).))..)).((((..(((..(........)..))).))))((((((.....)))))).(((..((((..(((((....)))))..))))..))).................))))))))((((((.........))))))...))))))))))))))....))))..)).))).)))))))))((((.....))))....))).).)).))))...)))))))).))))))))))))).....(((((((((.((((((((((((((..........)))))))))))))).))))......)))))....................)))))...)..).)))).)))).))))))......(((((.........))))))))..
Thermodynamic Ensemble Prediction
...,,......||(.((((((.(((((((((,.{(((((((((..{{(((((((,(.,,,,.(({((((,,.(({(.((.,.(((,.(((((.....))))).)}}{{.{{((((((({...((((...))))..|,})))))).}},)).)))))}|}},,,))))))))}|,.,(((,,,.||}..,,.((((((((((((((..(.(((..{((({{(((((((((((((...((((.(((....))).))))..))))((((((((((..((((,{(((((((..,,,,,...,|||.((((((((....(((((.(((((((((.{{.(((((.(,,(((......))).,),))))).)}..((((((.(((((((,((,,,.,,)),,.)))))))..)))))}((((({{.{{{...{{(,((((((((((..,.....})))}|.,.}}}}}},...,.,))}}))).},,.((((((.....))))))((((((((..((((((((((.(((.......))))))))........(((((...,,,,,|}|||..,.....(((...{{|,||||,||||...)))},..))))..}}}|..,,....,})}},,,......((((((((.(((.((((((.(((.((.(((((((((((((({..,,,||,{,.,..|{{{{{.|||{,||||.,}}}}))))...,}||||,||},},,)),),})))))))...)))).))))).))))))...))).))))))))..)))))))))))))))))))))).))))).((((({{....}}..})))}(((..((((((((((((((....))))))))...))))))..))))))))))).)}.,.(((((((({.....,,..,..,......{(((((.....)))}}}}((((((.((((((..((((((((((((..((((((((((..((..{.{((((((.((((....{{{.{{......}||}|(((((((((((.....))))))}.,|||||....|||||{{{({((.{{.......((((((...))))))......,..,,...{{{((({,.{((,...}}}..}..,))})))||.(((((((((.((((....))))..))))))))).......(((..((((,...,))))..)))...}}}}.})))))))}...)))).))))))),{((((((..(((({{((({{{(((((((((..,{.((((.(((({{{{.{({,.,,,,.}}}}......,,,,..,,,,{,.......,,...........((.{({{....)))).)).}))}}}|},,,,.{{((((({((,,((((((,(((.(,{{{{{(,,,{{{,..,})})))),)}).)))))).(((((((.........)))))))||...{{((({.{{{{.{.{((,,.,{{{..}))}|..((((({...(((((...........,((({{,(((((...,})))}(((((((.((.....((((((.,{{,.{(({.((({(((((((((((((((((((..((.((((((((((((((.(((((((.......(((((((((.(((((((((.(((((((((((((((((((((({.(((((((((((((.(((((((((((((((.(((.(((.((((((((((......((((((((((((((((({....)))))))))|,,.((((((....(((((((((((((((.((((((((((((((((((((((.(((((.((.((((((((((((((((.(((((......))))),{{{..,,|}}}..{{.{{.(((.(((.(((({...,)))).)))))).}).}).{{{.|||{....,)).}.}}}...)))))))))))))))).)).))))).)))))))))))))))))))))).)))))),}))))))))..)))))).,,.........})))))))..,...)))))))))).))).))).))))))))))))))).))))))))))))).})))))))))))))))))))))).))))))))).))))))))).......))))))).)))))))))))))).))..))))..})))))))))))))).}))},.,))},.,,)))))))).))))))).............,{{{{,|.......,.,.})},)))}}}}})))))..}))))).)).)).,),))})..))))))...,|,,,.}}}}})))}.)))))))))))))))))))))))))),,..))..))))))))))..|||,.....,||,..{(((.{(((.(((({...)))))...)))).)))}.}}}})))))))))..))))......)).)))))}.}},....,,))))))))).((((......(((((((.((((((((({{......,,,,((((((...{(({...}))))))))).|||,...,,{|....))))))))))....))))))))))..))))))))))))))))....)),}))))))).....(((((((.......))))))){((((((((,,..,,.,{.((({{....{{||{{..(((....}}}..}}..,||,,,.,|,|}||,,.,),})).((({..(((..{........}..))).})))((((((.....)))))).{((..((((..(((((....)))))..))))..})).........,.......))))))))}{((((.........}}},,....))))))))))))))....))))..)).))),,))))))))((((.....))))...,}}},},||,|}||...}}}}))),,)))}||||||}||...{{(,,,,((((.((((((((((((((..........)))))))))))))).)))).....))),,).,,,,}|,,,.....,,,,.)))))...},.)})))).)))).))))))......(((((.........))))),}}..

Transcripts

ID Sequence Length GC content
AGAGCCAGAGAGCGCGCUGGGCGGUGCUGGGCACCCGCGGAGUGGAACG… 3064 nt 0.4716
Summary

Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, isk-related subfamily. This member is a type I membrane protein, and a beta subunit that assembles with a potassium channel alpha-subunit to modulate the gating kinetics and enhance stability of the multimeric complex. This gene is prominently expressed in the kidney. A missense mutation in this gene is associated with hypokalemic periodic paralysis. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans using whole transcriptome sequencing of heart tissue from sudden unexplained death (SUD) cases and controls identified the KCNE3 as a differentially expressed cardiac-related gene, with mutations reported in ion channelopathies or cardiomyopathies [Neubauer et al. DOI:10.1007/S00414-025-03414-4]. A separate forensic investigation in humans developed a targeted RNA sequencing protocol for time-of-day prediction from bloodstains, where the KCNE3 was initially included as a candidate mRNA marker but was excluded from the final panel after testing due to a lack of statistically significant expression differences for this application [Gosch et al. DOI:10.1016/J.Fsigen.2025.103287].