| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGCCAGAGAGCGCGCUGGGCGGUGCUGGGCACCCGCGGAGUGGAACG… | 3064 nt | 0.4716 |
Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, isk-related subfamily. This member is a type I membrane protein, and a beta subunit that assembles with a potassium channel alpha-subunit to modulate the gating kinetics and enhance stability of the multimeric complex. This gene is prominently expressed in the kidney. A missense mutation in this gene is associated with hypokalemic periodic paralysis. [provided by RefSeq, Jul 2008]
A study in humans using whole transcriptome sequencing of heart tissue from sudden unexplained death (SUD) cases and controls identified the KCNE3 as a differentially expressed cardiac-related gene, with mutations reported in ion channelopathies or cardiomyopathies [Neubauer et al. DOI:10.1007/S00414-025-03414-4]. A separate forensic investigation in humans developed a targeted RNA sequencing protocol for time-of-day prediction from bloodstains, where the KCNE3 was initially included as a candidate mRNA marker but was excluded from the final panel after testing due to a lack of statistically significant expression differences for this application [Gosch et al. DOI:10.1016/J.Fsigen.2025.103287].