Basic Information

Symbol
KCNG1
RNA class
mRNA
Alias
Potassium Voltage-Gated Channel Modifier Subfamily G Member 1 KH2 Kv6.1 K13 Voltage-Gated Potassium Channel Regulatory Subunit KCNG1 Potassium Voltage-Gated Channel, Subfamily G, Member 1 Voltage-Gated Potassium Channel Subunit Kv6.1 KCNG Potassium Channel, Voltage Gated Modifier Subfamily G, Member 1 Potassium Voltage-Gated Channel Subfamily G Member 1 Potassium Channel Kv6.1 Potassium Channel KH2
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_002237.4
Sequence length
2189.0 nt
GC content
0.6606

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-989.90 kcal/mol
Thermodynamic ensemble
Free energy: -1025.13 kcal/mol
Frequency: 0.0000
Diversity: 774.57
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((.(((((((((((((.(...(((...........)))..).)))).))))))))).(((((((....((((((....(((((((........))).(((((((((..((((((((.(((...(((((...(((.((..(((((.((((((((((((.((((....(((.(.((((.((..........)).))))..).)))..)))).)))))))))).)).)).)))..)).))))))))((((((..((...........))..))))))...(((((.....)))))...........))).))))...))))..)))))).)))))))....))))))....))))))).((((((((((((((.(((((.((...))))))((((((((((.((((((((((((.((.(((((((((.(((((((((((..(.(((((((((.(((.((.((............((((((...........))))))...))))))).))).)).))))).))))))).)))).)))..(((.(((((((.(.......((((.((....(((...((.((((.((((......))))..)))))))))....)).)))).........).))))))).)))......(((.....(((((((.(((((..((.(((((..(((((......(((.(((((((((..((((.((..(.((.((((.(((((((....(((((.((((((((.((((.(((...)))))))))).((((.(((..........))))))).((((((((.((((.(.((((((.((((((((((....)))).(((((.((....))..)))))(((...(((((((.((((((.(((((.(((..((((((..((.(((......))).))..))))))..))).))).)).)))..))).)))))))))))))).)).)))))).)..))))..))))))))..(((((((.(((((..........).)))).))).)))).(((((((.....))))))).((((((......)))))).....((.((.(((((((..(((((((((..(((....)))..))..((((((.......(((((..(.....)..)))))..)))))))))))))..))))))))).))..))))))).)))))))))).)))).))).)).)))).)))))))))))))))))))))).))..))))))))))))...)))..((((.....)))))))))).)).)))))...))))))).))))))))..))....).))))).))))))))).(((.....)))((((((((.((..(((((((.(((...((....))..))).))....((((((((.(((((.....(((((((((.((((((((((((...((.((((((....((((((........)))))).(((((((((.(((.....((((........))))))).).)))))))).......((((...((.(((((((((((.....((((.(((((((..((.((((((.....)))))).).)..)).))))).).)))....))).)))))))).))..))))........................(((((.....)))))...)))))).))..)))))))))))).....(((((......)))))..........(((((..(((..(((....(((((((..((.(((.....((((((((((((((.((.....(((.........)))..)).)))))....(((((((((.((.((..(((((((......((....))......))))))).))..))..)))).))))))))))))))))))))))))))))))))..))))).)))))).(((((((..(((.........)))....))))))).........))).....))))))))))))).)))))..)).))))))))(((((((((((((((((.....)))))))...((........))........((((((((........))))))))....))))))))))((((.......))))((((((((....))))....))))(((((.((.......................)))))))....)).
Thermodynamic Ensemble Prediction
((.,{{(((((((((({({,.{{({{{{(,,,.,.||((,|{{,,|.({|||((|(((({({{(((,{(((({(({{((({.{{{..||,,|}},{|||{|||{||,,(((((({{,{(({{{(((({..,(((.((..(((((.((((((((((((.((((....(((.(.((((.((..........)).))))..).))}..)))).))))))))))}}).)).)))..)).)))))))}((((((.,{(,......,...}}..))))))...{|||||....}))))...........|)).)))).,})))).,)))))).))).},..}}.)))}}}}}|})))))||.((((({((({,,,,.{((|{|{,...,}||}}((({(((((({({({((((({{{.,({(((((({(({({(({(,{((({{,{((,,.((((((..{({,,....,,,..))..)))))).....,.,||{||||||,,||..,,,||.||,}},}}}}||||}}|||{||}.{||{,,{|{.{{(((((,{.......((((.((....{{{..,{(,((((.((((......))))..}))}}})})....}).)))},,|.....|)}})|}}}}.|||,.....}}}.},.,{(({(((,(((((..((.{{{|||}||||{|,....{|{,(((((((((..((((.((..{,((.((((.(((((((....(((((.(((((,((.((((.(({...}|}|}}|||.{((,({{.....}|}}}}||||||||.((((((((.((((.,,((((((.((((({((((....)))).(((((,({...,)}..)))))(((...(((((((.((((((.(((((.(((..((((((..((.(((......))).))..))))))..))).))).)).)))..))).))))))))))})))},).)))))).)..))))..))))))))..{((((((.(((({..........),}))).)))}}}||,(((((((.....))))))}.((((((......)))))}....|||}||{((((({{{{(({((({({,.(({...{|||,,}}|||{({{{{{{....|||{||||,||,,|.,|||,,,,||)})))))}}))|.}}))|}}}}||)}.))))))).)))))))))).)))).)),.)).)))).)))))))))}))}))))))))).))..)))))))))))},..,,}||{{{{.....))))))))))})).)})))||||}|)))){||||||||{{{|......,))))})),,))))),{{,,,.}}}||||}|||||.|{}|||||||,,,)}))))})))))),)))}}},}..}|||||||{{((({{,,,..,,{((((((.(((((((((({{{..((.((((((,...((({((........))))}}.(((((((((.(((....,((((....})}.))..))).).)))))))).......{{{{...((.((((((((({{.,||||||{|(((((((..,,.((((((.....)))))).}.),.)).)))}}.}.)}},,.,))),))}))))}.})..)))}...||..........,.,,,,,..(((((.....)))))...}))))).))..))))))))))))....,((((|....,,,))))..........{((((..(({,.{{{,{||(|((((,.||||{.,||,.,|,|||,|||||||||{|},|,}{{{.,.......|}).|}}|}))))....(((((((((.((.({..(((((((......((....))......))))))).)}..))..)))).))))),))))))))))}))))))}}))}))))..))))).)))))),(((((((..(({.........}})....)))))))..,.......,......,||}|||||||,,.))))))).)),||||}},||{{{|||{|(((((((.....))))))).,,||...,..,.)}......{.((((((((........))))))))},,,})}|||||}|{{}|||.....,,,{((((((((....))))}...})))|{|||.||,.,,,,.................)))))),..,,)).

Transcripts

ID Sequence Length GC content
GCACUCGGAGCCCGGCGGGGACCGGGAGGCAGAGACGGGGCGGCCGUGG… 2189 nt 0.6606
Summary

Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This gene is abundantly expressed in skeletal muscle. Multiple alternatively spliced transcript variants have been found in normal and cancerous tissues. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the KCNG1 was identified as a candidate forensic biomarker of hypothermia, showing a 0.517-fold reduction in expression in lung tissue from hypothermia-exposed animals compared to controls via DNA microarray analysis [Takamiya et al. DOI:10.1016/J.Legalmed.2020.101789].