Basic Information

Symbol
KCNG4
RNA class
mRNA
Alias
Potassium Voltage-Gated Channel Modifier Subfamily G Member 4 Kv6.4 Voltage-Gated Potassium Channel Regulatory Subunit KCNG4 Voltage-Gated Potassium Channel Subunit Kv6.3 Voltage-Gated Potassium Channel Subunit Kv6.4 Potassium Channel, Voltage Gated Modifier Subfamily G, Member 4 Potassium Voltage-Gated Channel, Subfamily G, Member 4 Potassium Voltage-Gated Channel Subfamily G Member 4 Voltage-Gated Potassium Channel Kv6.3 KV6.3 KCNG3
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_172347.3
Sequence length
5503.0 nt
GC content
0.5488

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2089.80 kcal/mol
Thermodynamic ensemble
Free energy: -2179.15 kcal/mol
Frequency: 0.0000
Diversity: 1419.56
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.........(((((..(....((((..((((..((((((((((..(((......)))..))))...))))))......................((((.(((.....(((((((((((((.((....)).))))))((((...((.......))...))))(((((((((.(((((...(((((((((((.......((((..(.((........)).)..)))).....))))))))))).....))))).)))))))))........)))))))......))).))))...........((((((((((.(((((((....((.(((...))).)).((((.((((.....))))..)))).....((((((((((((((..((((((((.(((...(((.(((((((((((......((.((((......))))))........((((((((((((((((.(((.((((.(((((.......)))))...))))..........((((((((.((((((((((((((((((........)))).))..........(((((((.((((......((((((..(((((.....)))))......(((.(((((((((((((.....)))))(((((((....)))))))..((.(((((((((((.....))))..)))))))))............((((((((.....((.(.(((((..(((((((.((..(((((...)))))......((((((((((...)))))))))))).)))))))..))))).).))..))))))))(((((..(..(((((((((((((((((((.(((..((((((((((.((.((...((((.......((((((.(((((..((((((...((((((((((((...(((.(((((((.((((((.((.((...((((((((((.......((((((...(((.......))).)))))).(((((((((.(((((.((.((.(((.((((.....)))).))))).)).).))))..((((....(((.(((.((((((((((((((((...(((((((.(....).))))).))...)))..(((((.......))))))))))))).(((((.....(((((.(((((.(((.............((((((.....)))))).(((((((......(((.((......)).))).....)))))))...(((....)))))).))))).))))))))))....((((.((((((((((((((.............(((.((..(((((.(((((((((((.((((.....((((.....))))..)))).)))))(((((.....))))).(((((.((((((..(((..((((((...(((((((........)))))))...))))))))).((((.(((.(((....((((((((((((.(((.((....)).))))))))....((((((((((((((.....(((((((((((..................))).))))..))))))))))))))..))))(((((((((......)))))))))(((((.......)))))((((((((((((........((((.(((.(((((........))))).))).)))).))..))))))))))))))))).))).))).))))(((.......(.(((((.....))))).).......)))...((((((....((((.....))))....)))))).)))))).))))))))))))))))..)).)))............(((((((..(((........))).))))))).....))))))))....((((....))))...)))))).))))........))))))))..)))...)))).))))))))).......((((.....(((((....)))))...............(((((...(((.......)))))))).(((.((.((((.((((....))))..))))..))...)))............))))((((((((..(((.((((((.((...)).))))))..)))))))))))(((((......)))))((((((........))))))............)))))))))).......)).)).))))))..))))).)).))).)).))).)))))))..))))))....)))))))))))))))....)).))))))).)))))))).))))))).)))....(((.....(((((((....))))))))))((((......))))......................))))))).))..)..))))).......))))))))...)))...))))))..))))))))))).))))).)))))))))).(((..((((((((...........))))))))...))).....(((((.((......)).)))))...))))).(((.(((((..(((((....(((((((.((((...((((((((...(((..........))).)))))))))))).....((((((..((((((...((.....)).))))))))))))....((((((..(((.((((..........(((.(((((...((((((..((((.......))))..)))))).....)))))))))))).))).))))))..)))))))..)))))((((((((.((.(((.(((..(((((((.((((.....)))).)))))))((((.((((((((....((((....)))).((.((((.(((............(((((.((((((..........)))))))))))((((((.......(((.(((((..(((...(((((((....((....))..)))))))))).....))))))))......))))))..(((((((((((..(((..(.(((((..(.((((((........)))))).)..))))).)))))))))))))))))).)))).))))).)))))))))))).))).)).)))))))).....(((......)))))))).))).)))))))))..)))).))))))..))))))))))....).)))...))).))))))))..))))))))((((((((......((((.((((.((((....))))((((((.((((((((((((((.(((..((((((((((((((((((((.((((((((....((((((((((..((((((.(((..(((.(((((..(((.((.((((((.((..((((.((((.((..((..(((.....)))..))..))))))..))))..))))))))..)).)))..))))).)))..)))......))))))....(((((..((((((.((((.((((..((.(((((....(((.((((.(((.(.(.((((((...((((..((((((.(((((((((...........)))))........((((.(((.(..(((.((((((((..(((..((((...(((((....)))))((((((.(((((..(((((...))))).........))))).))))))....(((.........)))....((((((((.((.(.(((((.(((.((....)).))).))))).).)))))))).)))))).)))...))))..)))).))))))))))).((.....))))))..)))))).))))))))))).).))))))).)))...)))))))..))))))))...))).......)))....)))))..............((((..((((((...((((..(((((((...)))))))(((((...(((((((((.....((((......))))...............(((...))))))))))))))))).......((((((((.((.(((......((...))...))).)))).)))))).(((((........)).))).(((...(((((((((((((((((.........(((((((((((((((..............(((((((.....)))))))....((((.((((((((((((((.(....)))).)))))))..)))))))).(((((((...((((......((((((((.((((.(((((((.(((((((((((.........))))))))))).)))))))))))........(((.(((((..........))))).)))(((.(((...))).)))((.(((((.((((.......((((....)))).)))).)))))))..((((.......((((((......)).))))(((((((.((((((((((((((.......................)))).(((((((.....))))))).....)))))).)))).)))))))......))))....((((((((.((((..((((((....(((..(.(((((((((((...((((((((......))))(((.(((.....((((((((..(((((((..(((((((.(((.(((.(((((..((((...(((((...((((((...)))))).)))))...))))..).)))).)))..)))...))))))).)))))))))))))))(((((..(((((((((((.................((((.((....))....))))..........((((.((((.............))))))))....))))))))))))))))....(((((.(((..(((.....))).))))).)))..))).)))......))))...)))).))))))).).)))....))))))(((((((((..((((((((..........))))))))....((((...))))..)))))))))((......)))))).))))).)))...))))))))......)))).......((((((((...(((.(.....................).)))...)))))))).))))))).....)))).)))))))))))...))))))))).))))))))....)))..))))....))))))..))))))))))...))))..)))))).)).)))))))).))).)))).))).))..).)).)))))))(((....))))))))))..))))))....))))))))......))))))))..(((......))).......(((((((((((...((.....)).....(((((....)))))........................))))))))))))))))).(((((.((.(((....))).)).))))).....)))))))...))))))))))......(((((((.((((......))))..)).)))))(((((..........))))).....))))..))))....)..))))).
Thermodynamic Ensemble Prediction
.........(((((..{....((((..((({..((((((((((..(((,.....})),.))))...))))))......................((((.(((.....(((((((((((((.((....)).)))))){{{{...((.......}}...})))(((((((((.(((((...(((((((((((.......{,{{.,(,{(..,,,,,.}}.)}})))),,...))))))))))).....))))).)))))))))........)))))))......))).)))).....,,.,..((((((((((.(((((((....{(.(((...))).}}.((((.((((.....))))..)))).....((((((((((((((..((((((((.(((...(((.(((((((((((......{,.{(((......}))),,.....,..((((((((((((((((.(((.((((.(((((,......)))))...)))|{{{.......{||||(((,((((((((((((((((((........)))).))..........(((((({{((((......((((((.(((((,...}})))))}}}|..(((.(((((((((((((.....)))))(((((((....))))))).,,(.(((((((((((.....))))..)))))))}}.,|,.......,((((((((.....((.(.(((((..(((((((.((,.(((((...)))))......((((((((((...)))))))))))).)))))))..))))).}.)).,))))))))|((((..(..(((((((((((((((((((.(({..((((((((((.((.((...((((.......((((((.(((((..(((((({.,((((((((((((...((({({({((({(((,{,.,,((((((({,{,{((((({{,{{.((((((...(((.......))).}))))).,{{|{,,,,,(((((,((,((.(((.((((.....)))).})))),)).)))})),..||||}}}|||||||}|,,|.|||||||,||||,.{,{((((,{....),))))).||{.|||,..|||{{,,,....|||||||||||||..(((({{{..,,.,,.(((((.(((....,,,,,,,..{(((((.....)))))).(((((((..,.,{(((,((.....,)).})).....)))))))...{{{..,.))}))).))))).|{{{{{{{,,....((((.((((((,((({{,,....,|,..,,.{((({(({{((((({((,,,((((((.((((.....((((.....))))..)))).)))))|,{{({{{{.|||{(((((,({(((((({.(((..((((((...(((((((,.....,.)))))))...))))))))).|||({((({(((,,,,((((((((((({,(((.((....)),)}}))))))}}|||{{((((((((((.....(((((((((((..................)))}),))..)))))))))))))}..||||(((((((((......))))))}})|||||,,,....)),||((((((((({,,.,,.....((((.(((.(((((.{....}}))))).))).)))).}}.,}))))))))))}||||},},,.})),))})||{..,....|.{||{{.....))))).),,,....}}}...((((({....((((.....))))....)))))),))))))))))))))})))),))).))))).,})}},..,}}}}(((((((..(((........))).))))))).....,}})))))}}..||||,,..}}}}...)))))).))))........,||||||{...))}}}})},.,},|||,||,||,...(({{.....(((((....)))))................((((((((((((((({{,{,,{({{.,........}}}}.}|}))}}))))))).)).)).,))))..,.........)))}((((((((..(((.((((((.((...)).))))))..))))))))))))))))}}}...,,,.{((((((,,...,,.))))))).,}))}}}.))))),))))))}}....{{{{{{{,,,|{{{.......)))),,.))))))}))))))},,}})))),,..)))))))))))))))....)).))))))).)))))))).))))))).)))....((..,.{{,{((,{.{((((((.......))))))}..,))}}.,,.,}..,,{......,,,..))))))).))..)..))))},......))))))))...)))...)))),}..))))))))))).})}}},,}}})))}})|({{,,({{{{(({.,.....,.,.|}}}}|||{{,.,,....{((((({(.....{{{...,(((({.{{{{{{((({(({{{{,,{.,,,{..((,{{(({(((,...,,,|||||}}}||{{....,{{{.|||,||||||||,||,,,,..((((((..((((((...({,...,)}.))))))))))))...((((((....)))))).,,,,,,.{|}|||,{,,{(((,{((((,.(((({.{(,,{(.((((..,((((...,(((((({{{..,,,)),.)))))).}}.}})).)))).))))}))))...})))))))},,|||||||,||||,....))||,||||||},,,....},|}},,}||||{{..,,))}}{{{{|||||(({..,,,....}}}((((,{((((((..........)))))))))))|||||{..,..,|||||,..||}}|||...(((((((....((....))..)))))))||||},..}})).,,,,,,.,,||||||(,{((((((((((..(((..{.(((((..{.((((((........)))))).}..))))).}))))))))))))),)}}),,}))))))).))))).,}}))).,,,.)))))))),},.....|||},....}})}))))}))).)))))))))..))))}})))))..))))))))))...,}.)))...))).))))))))..)))))))|{.{((((.{{{{.,,.((.{,.((((((,.,,{({,(((,{((((,(((.(((((((.(({..({((((((((((((((((((.((((((((....((((((((((..((((,(((,({.(((.(((((..(((.((.((((((.({..((((.((((.((..((..(((.....)))..))..))))))..))))..}}))))))..)).)))..))))).)))...||{|||||,,,,,,}}}}|||....{{{{((.((((.((((..((.((({({...(({.((((.(((.(.{.((((((...((((..((((((.((((,(({{..,....,,{,}||||,.....,{((((,{{({({{((({(,,,{{{,,,((({.(((|{{{,((,,..}}})),}||{|||.{{|{{...,|||,,|||,,,...,.....))))).})))))..||||{.,||,,,.})),.,..|,((((((.(,.,.(((((.(((.((....)).))).))))).}.)})))))),)))))}{||}.{{||,,{{{{,..,.,)))),,))}},.})}.),))))..)))))).})))))))))).).))))))).}))...)))))))..)))))))).,,}}}.......})}},))),))))...,,,...,},.((((..((((((...((((..(((((((...))))))){((((...(((((((((.....{(((......))))...............({,...,)))))))))))))))}.......((((((((.{{.(((...,..((...)}.,.)}).)})).)))))){(((.,,,{{{.,.,..))),.||...(((((((((((((((((.........,{{{{{{{{{{..,,..............(((((((.....)))))))....((((.((((((((((((((,(....}))).)))))))..)))))))}.||(((({,,,({{{......(((({(({.(({(((((((((.(((((((((((.........))))))))))).)))))))))}){{{{{{{,{,,.||,,|}}}}}}....,,}||.|||(({.(({...})}.})}||.{{{((.(({{,,|,,|.{(((..,.}}||,|,}},))))))},}||{,...,...((((((......)}}})))(((((((.(((((((((({{({.........................,}.(((((((.....))))))).....)))))).)))).)))))))......}})},,,,||{{||||,||||,,((((((....(((..,.(((((((((((...((((({(,{{{,....))||{,{{{.....((((((((..(((((((..(((((((.(((.(((.(((((..((((.,.(((((...((((((...)))))).))))).,.))))..).)))).)))..)))...))))))).)))))))))))))))(((((..(((((((((((.,........,,,.....,,,.((....))....,,}}...,......((((.((({.............})))))))..,.))))))))))))))))....(((((.(((..(((.....))).))))).)))..))}.,},.....,))))...)))).))))))).}.)))....)))))){||{{{{{{,.{|||||{{.......|..})))}})),.,{({((,,,))}}|.|}))))))}({......))||||{|,,,,})))}}.}}}))|}}....,,}))).......((((((((...{{{.{.|.....,,.,,,......,.,,)))...)))))))).})))))),.,,,}},,.}}})))))}}),},))))))))),})))))))..}}))...))))....))))))..)))))))))),..})))..)))))).)).)))))))).))).)))).))).}}..).)).))))))){((....))}||.....,,,,,))).))))).)))}))...}))))))..})}|||.}}}}.)))})}.}},{((((((((((...,.....,,,.....(((((....)))))....,.....,|,...........)))))))))))}))))).{{({{,((,((.....,}}}))}))}}).....)))))))...))))))))))....,,(((((((.((((,....,))))..)).)))))(((((..........))))).....})))..))))....}..))))).

Transcripts

ID Sequence Length GC content
GACAGCUGCCCUGGCUCCCUCCCAGCAAGAACCCCCAGACCCUCAUCUC… 5503 nt 0.5488
Summary

Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member functions as a modulatory subunit. The gene has strong expression in brain. Multiple alternatively spliced variants have been found in normal and cancerous tissues. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the KCNG4 was significantly downregulated (0.11-fold) in injured dorsal root ganglia following spinal nerve ligation, indicating its involvement in neuropathic pain [Wu et al. DOI:10.1177/1744806916629048].