Basic Information

Symbol
KCNH1
RNA class
mRNA
Alias
Potassium Voltage-Gated Channel Subfamily H Member 1 H-Eag K(V)10.1 Kv10.1 Eag1 HEAG Eag Potassium Voltage-Gated Channel, Subfamily H (Eag-Related), Member 1 Voltage-Gated Delayed Rectifier Potassium Channel KCNH1 Voltage-Gated Potassium Channel Subunit Kv10.1 Ether-A-Go-Go Potassium Channel 1 Ether-A-Go-Go 1 EAG Channel 1 HEAG1 Potassium Channel, Voltage Gated Eag Related Subfamily H, Member 1 Ether-A-Go-Go, Drosophila, Homolog Of TMBTS ZLS1 EAG1 EAG
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_172362.3
Sequence length
8140.0 nt
GC content
0.4979

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2794.30 kcal/mol
Thermodynamic ensemble
Free energy: -2942.75 kcal/mol
Frequency: 0.0000
Diversity: 1915.01
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((.((((...)))))).(((((.(((((((.((((((.(((.(.((((((((..(((((((((.(((((.((((((.(((((((.((((.(((((((((.....)))).))).)).)))))))((.((((((.((..((((.(((((.(((....))).))))).).))).))..))))))))..((((.(((((.(((........)))))))).)))))))).)))).)).))))))))))....(((...((((..((((...))))((((.(((..((((((.......)))))).))).))))))))..)))...))))....((((((.(((((((((...(((((((.(((.((((.((......)).)))))))..)))))))(((((((((.((((......)))).((((.(((((((.....(..((((.((..(((((((.((((((((...(((((((((.((.((...((((......((((........))))....)))))).))..)))))))))....(((((((((((..((((...))))..)))....)))))))).....(((((((..(((((........(((((((...(((((...((((.....))))......)))))..))))))).((((.........)))))))))...((.(((((.....))))).)).(((.......)))))))))).(((((.((.(((......))).)).)))))((((((((((.......((((.(((((.(((((((((((((((((........(((((((((......(((((....((((((((....))))....))))....)))))...((((((...))))))...........(((((((.((.(((((.((((..(((((...........)))))..)))).).)))).)).))))))).(((((((((...))))))))))))))))))....)))))))..................(((((...)))))))))))).))).))))).))))..........((((((((((........))))))))))...)))).)))))).))))))))...((((...)))).)))))))..)).))))..)..))))))).))))..((((((((..(((((.(((((((...))))))).....((.(((....))).))((((((((.(...((((((..((((((((((((((((((((..((...((((((.(((((((.((.((.((((((.(((.....))).))))).).)).)).))))))).)))((((.((.((..((((((((((.(((......)))))))))))))..)))).))))..(((.(((((..(((((..(((((((((((.((((((...((..(((((...((....((((.(((((((.(((........))))))..(((((..............((((..(((((((.(((((((((((((((((((..((((.((((.((((...((((((.(((((((.....)))))))..((((.(((....))))))).((((........))))........(((.((((..........(((((((((((...))).)))).)))))))).)))....(((((...((((.(((.....))).))))...)))))........................))))))....)))).))))(((....)))(((((.....(((((((.(((((((..(((.((((((((...((((........)))))))))(((.(((((....))))).)))((((((((((((((.(((((((......((((((.(((((((.((((((((((((((((.........(((((((...))))))).((((....))))((((((((((.((((.((((((((....))).)))))...))).).)).))))).)))(((((((.((......((((((.((.((((.((.......)))))).)).))))))....)).)))))))..((((((((((((((..(((((.((((..((((((....(((((.((((((((((((((((((((((((((.......)))).))...(((.((((...(((.(((((.....(((.((.(((((.......))))))).)))..))))))))....)))).))).((((.((((...(((...((((.(((((.(((((((.(((((((...................))))))).))))))).)))..)).)))).))).)))).))))..))))))))).......((((.(.(((....))).)))))(((.((((((......)))))).(((((((.(................).)))))))..)))((((((((.(((((((((((((.((((((((.(((((.((((((.(((.(((((.(((.((...)).))))))))..(((...(((......)))..)))..((((((((..((.(((((..........))))).))..........((((.(((........))).)))).))))))))..((((((((((.(((((.........))))))))...(((((((.((((((..((((((...))))))..))(((((..(((((...(((.((((((((((((((.((((..((((((...((((((.((((((((((.(((.((((((..((....))........((((.(((((......((.....)).....))))).))))))))...)).)))....))))))).)))))))))..(((.((((((((((.(((..(((((((.((....)))))))))..(.(((..(((....)))..))).)...(((((((.(((((((((((..(((......((.((.(((((((.((((.(.((((((.....((((((.................(((((...(((((((((.((((((.(((.(((((.((........))..)))))...))).).))))))))))))))..))))).)))))).((((((((((....(((((((((.....((((((....(((.....(((((((.......)))).)))..)))....))))))....((((((....((((((((((.......(((.....)))......(((((...((((.....))))...))))).))))))...))))....)))).)))))))))))((((......))))..(((.((((........)))).)))......(((((.(((((.((((................((((((..(((((((.(((((........))))).)))))))..((((((((((((((.............))))))))))))))...))))))))))))))).)))))))))))))))..(((...((((((.((((((((((((((....(((((..(((((.........)).)))..)))))..)))).))))...)))..))).)))))).))))))))).).)))).))))))).)).))....)))...))))))).))))...........)))))))...(((((.(((.((((..(((..((((...(((((((..(((((((((((.((((....))))))....(((((.((((((((((....)))........))))))).)))))(((..((...))..)))...((((.(((((...((((..((((....((((.((((((.((((........)))).)))))).))))...))))...)))).))))).))))......)))))))))...))).))))))))..)))..)))).))).)))))....))).)))))))))).)))((((......)))).)))))).)))).).))))))))((((((((((....(((.((....)).)))(((((((((((....((((.(((((..((((((((((((......))))))........................((((.(((((....)))))))))..))))))...)))))..((((.(((((((((.........((((((..(((((((.(((((......))).))((((((((((((((((((...............(((((((((((((((((......)))))))(((((........)))))..(((.(((((........))))).)))((((((((((((((((....((......))...)))))))))).))).)))..))))))))))...)))))...))).))))))))))))).)))).)))))))))))...)))).))))..))))...))))..)))))))))))))))))....(((....)))..((((((.((.((.....)).)))))))).(((((((................((((.(((......))).)))).(((.((((...)))))))(((((....))))).)))))))(((((((...........))))))))))))))).)))))..(((.(((((..(((...((((((((...((.(((((((((..(((((((..(.((((....)))).)..).))))))(((((.((.....)))))))....))))))))).))....)))).)))).))).))))).)))(((.(((.(....).))).)))..)))))........)))).)))).)))..(((((((((((...(((.((.(((((..((.(((((...))))).))))))))).))).))))))))))).((((((((((((((((((((..(.(((......))).)..)))....))))))))))...)))))))....((((...))))............)))))))))))))))))))....((((((...))))))...)))))))))).))..............((((.(((((((.((....((.(((..(((((((...)))))))((((((((((((((......))))))))...............))))))..(((((((..(((((((..((((.....)))).)))))))))))))).......))).))...)))))))))..)))))))))))....)))))).)))))).))).)))))))))))))...(((((((..(((((...((.....)))))))..)))))))(((..((((((((..((((((((((((((...(((......)))...))))..((.(.(((((((((((((....(((((((..((((.(((((((((((((.(((((........))))..).))))))).))))....(((((((..((...))..)))))))((((....))))......))))))..)))))))..))))))))))))).)))....((((....)))).......))).)))))))..)).)))....)))..)))..((((((.((((......))))..)))))))))))))))).)(((((...)))))))))..))))))))))))))))))))))))..)))))..).))).....)))).))...)))).....))))))).)))))))))).))))...((((((.......))))))(((.((......)))))..))).)))...))))))).))))).))..((((....))))..))))).)))))))))))))))))).(((((.......))))).))))))))))))..)))))))))........(((....)))((((..((((.((((....)))))))).))))((((((.(....((((((((....((..(((((.((.(((...((((...(((..(((((((..((((.(((((((...........(((((((((((..........((((((.((((..(((((.(((((((((((..((.((.(((((....))))).))..))...........((((........))))))))..)))))))..)))))..))))))))))))))))))...)))((((.....((((((..(((((((..(((((..(((((((((.(((((((.(((((((((........))))))))).))))..((((.........))))...(((..((..((((.(.(.(((((.....((((((.((((.((.(.(((....)))))).)))).))))))......))))).).).))))...))..)))))).)).)))))))..)))))..)))).)))(((.((((((((....)))))))).)))(((((((((((((((((((....(((((((....)))))))....))))))))))....)).)))))))((((((...((((........((((((...((.....)).))))))..........))))...)))))))))))).))))..)))))))..)))).)))).....)))..)))...)))).))).)).)))))..)))))))..)))....)))))))..(((((...(..((((.((......)).))))..)....)))))..(((((((..........)))))))((((((..(((((................)))))..)))....)))..(((((....((...(((......))).))..))))).....)))).))))...))...)))))..)).))))))(((..(.....)..))).......(((((.(((........))).)))))..))))).)))))).))))).))))).)))(((......)))(((((.........))))).......)))...))..))))))..((((((...)))))).............((((((((((((((((......)))))))..))...)))))))......(((....))))))).))))).)))))..))))))...)))))))))))))).)))))))))))))))))..(((((((((..((..((((((....).)))))..))..)))).)))))..............))))))))).)))))))))))))).).))).))))...........(((..((((((...(((.((.........((((((((......(((..((((((((.(((.(((........(((((((.....))))))).......))).))))))))))).)))......))).)))))((((...............)))).....((((((((....(((((((((....((((((....))).))).....(((.....(((((((...)))))))))).)))))))))..))))))))))))).)))))))))))))))))).)))))....((((((((...((((...))))......(((((((((((((.(......((((..........)))).....).))))).))))))))((((((((((........)))))........(((((.(((((...............((.((((((((((((((((((((.........))))).(((((.((.((((.......))))..)).)))))....((((.......((((..(((.(((((......((((..(((..(((((((.......((((........))))......((((((......))))))......((.((((((.((.....(((((.((........)).)))))....)))))))).))((((((((.......)).)))))))))))).)..))).))))....))))).)))..))))))))))))))))))))))))))))))...)))))..((((.((........)))))).........))))).((((((...)))))).......))))))))....((..(((((.....)))))..)).......
Thermodynamic Ensemble Prediction
{{.,{{{..{|}|{{|{(((((.((((((({((((((.(((.(.((((((((..{{{{(((((.(((((.((((((.((((({(.((((.(((((((((.....))))}})).)).)))))}}((.((((((.((..((((.(((((.(((....))).))))).).))).))..))))))))..((((.(((((.(((........)))))))),)))))))).)))).)).))))))))))....(({...(({{..{{{,...}))}((((,(((..,(((((.......)))))}.}}}.})))))))..))),,,))))....((((((.(((((((((,{{(((((((.(((.((((.((......)).)))))))..))))}},(((((((((.((((......)))).{(((.(((((((.....(..((((.((..(((((((.((((((((..,,,,,{,,{{.((,.,...{{,,..,...{|||..,.....}}}}...(((({{{{{{.{{{.|||,,|,{{.(((((((((((..((((...))))..))}...,))))))))....,..((({({,{{{({|.,,....(((((((...(((((...{(({.....}))}..,...)))))..)))))))||{||.,}},,.,,)}))).,}),,}}|.|||,|}}}}))))),.{{{(((.......))).)))....(((((.((.(((......))).)).)))))((((((((((.......((((.(((((.((((((((((,((,({(,,,,,,..(((((((({......({(((....((((((((....)))}....))))....)))))...{((((,...)))))).,.........(((((((.((.(((((.((((..(((((...........)))))..)))).).)))).)).))))))).(((((((((...)))))))))}}))))))),...}||}}}}...........,,.,,..{({{{...})))}))))))).))).))))).))))..........((((((((((........))))))))))...))))}}))))).))))))))...((({...)))}.)))))))..)).))))..)..))))))).))),..((((((((.,(((((.(((((((...}))))))...,|||.,,.....)))||{(((((((({(...((((((..(((((((((((((((.......(((.((((((((,,.......(((((.....)))))..)))))))).)))...,.,,....((((((((((.{.{((....{.((((((({((((((((.(.(((.(((((((((((,,{{,{(,..(((((((((.{(({({{{{.{{.,.{{{{|...})),.}.}))},....,}},|,......},.,)))))))))....))}.,)}.|...(((((..............((((.,(((((((.(((((((((((((((((((..((((,({{,.{{((...((((({.(((((((.....)))))))..((((,(({...,|||||}}.((((........)))),,,,,,,.{{,,{{({,,,,....,.(((((((((({...})),}))).)))),},,..}||...(((((...((((.(({.....})}.))))...)))))...},...................)))))}.},.,}}},}|||(((....))))}}}},,...{{(((((.(((((((..(((.((((((({..{((((........)))))))))(((.(((((....))))).))){(((((((((((({.(((((((......{(((|{.|((((((.{((((((((((((((((....,...(((((((...))))))),{|{{....}}}}|(((((({{{.||{{.{{{(((((,,,,))).|||}}..,))).),)),)}))).|||(((((((.((......((((((.((.((((.((.......)))))).)).))))))....)).))))))).}||((((((((((((.{((((((({{(,.(((((({...{((({,((({{{{{,{,||||,||||||||||..}}}}})}}},|{((((,{{((((...{({((((((,,...(((.((.(((((.......))))))).)))..|||||||},,,{|||}{||..,(((.((((...{({,,.((((.(((((.(((((((.{((((((..{.,......,,.,....))))))).))))))).)))..)).)))).))}.)))).))}|{{|||,}|||,.......(((,,(.(((....))).))))){{,.((((((......)))))).||{||||}|...,.,,,....,,{,|.,}||||}..|||(((((((({(({((((((((((.((((((((.({(((.((((({{((({((((,,(((.({...}).)))))))}..(({...(((......))).,)))..((((((((.,((.(((((,{....,|.,))))).})..........((((.(((,.......))),)))).))))))))..,((({({(({,({,({,,,.,.,,,}})))))},..{((((((.((((((..((((((...))))))..))|{(((,.(((((...(((,(((({(((((((((.((((..((((((.{,(((((,,((((((((((.,((,{,{,{{||({....))........((((.(((((......((.....}}.....))))).)))),}}|,..}).)),....))))))).))))))))).}(((.((((((((((.(((..(((((((.((....)))))))))..(.(((..{((....|||,,|||,|.,{(((((((.(((((((((((..(((......((.((.(((((((.((((.(.((((((.....((((((......,....,,....{((((...(((((((((.((((({.(((.(((((.,,........,},.)))))...))).}.})))))))))))))..))))).)))))).((((((((((....{(((((((({{{.,(((((({{,.(((.{{{(((({(((........,||{,,,,,}}}....)))},,....{{{{{{....{,,,{{{{{{......,({{....,)}}......{{{{{..,|{||.....}}}}...))))}.)))))).,,)))),},,))})}))))))))))|((((......)))),.{{(.(((({{,.....}))),))),....,(((((.(((((.((((....,...........{(((((..(((((((.(((((.,....,.))))).)))))))..((((((((((((((.............))))))))))))))...)))))}))))))))).)))))))))))))))..(((,..((((((.(({((({{({,((({...,|||||,{(({{{{,{.{{..||.||}..}}}))..}))}}}))),..)))..})).)))))),))))))))).).)))).))))))).)).))....)))...)))))))}})))...........))))))).{{(((.,.))))},((||(((|,((||,,,,,.{{{,..|||||||||||,(((,...{||||{{....(((({.((((((({{{,...,||,,,|....}}})))).}}|||((,..{|}},}|{{,|{{..((((.(((((,..((((..((((....((((.((((((.((((........)))).)))))).))))...)))).}.)))).))))).))))..,}..))),)))))},}}})},},)))))}})}).,}}))))))},)},.}}},))).)))))))))).))){(((......)))).)))))).)))).),}))))))){(((((((((....(({.((....)).)))(((((((((((||..((((,{{({{,,((((((((((((......)))))),.......................((((.(((((....)))))))))..,}})))...))))}.|(({{.{||||{{{(,{{{,{{{.,..,,,..,{{|||,}|}|||......}}|{|,{((((((((({{{{{{{{.....,,.,.,({{.((((((((({(((((((......))))))){{{{,...},...}))},..{((.(((((........))))).|||((((((((((((((((....,(,...,,,,...)))))))))).))).})),.}))))))))},,})))|),,|))),)))))))))}}}}.||}}.,)},,})))||,,.||||.,}},..)))).},)))}.})))))))))))))))))...,{((....})},,{{{{{({(({{{....,,|||||||||}{(({((((,........}}}}}.,||,..((((......))))))),|||}||{|.,,})))))}(((((....))))).}})}}}}(((((((...........)))))))})}}||||.}}}}}..{((.(((((..(((...((((((((...((.(((((((((..{((({({..{.((({....}))},|..|.}}}}}},||||||{,....}}}))}},,..))))))))).))....)))).)))).))).))))).))}{{{.{({,{|...)}))).))).,))))}........)))).)))).))}..{((((((((((...(((.((.(((((..((.(((((...))))).))))))))).))).))))))))))}.((((((((((((((((({((,.(.(((......))).,..}}).,,.))))))))))...)))))))...,(({,.,{|||,......}}}},.}))))))))))))))))))....((((((...))))))...}})))))))).))..............((((.(((((((.((....,,.{,...(((((((...))))))){(((((((((((((......))))))))...............)))))}..(((((((..(((((((..((((.....)))).))))))))))))))........,..}}...,})))))))..)))))))))))....)))))).)))))).,,},.,}}})))))))),..|||||{{,.|||||.,,}},.)))})))))),...||}||||}|||}{|||,{{.(((((((,,{((((...(((......)))...))))..,,,(.(((((((((((((....{((((((..{{(({(.(((((((((((.({{({,{,....}))),..).)))))))))})).}}}{((((((..((...))..))))))}((((....)))),,....,,})))..)))))))..))))))))))))).))}....((((....)))),......}}}.))))))),.,{,,{{{{,,{||..|||..||,|||..,||,}}}..))))))}}}}}}||||}.}))})}{||||,.,|||},.,)),,))))))))))))})))))))))))..)))))..}.))))},..}}))|),...||||.....))))))).)))))))))).)))}...{(((((.......)))))){{{.||.,,...}}}},..))).)))...))))))).))))).}}..,,,{...,}))),,},}}}.)))))))))))))))))).(((((.......))))).)))))))))))),.))))))))),{{{....{{{....)}}((((..((((.((({....}))))))).))))((((((.{....(((,(({,...(((,.(((((.{{.(((...((((...(((..(((((((,.((((.(((((((........{{(((,((((((((..........((((((.((((,.(((((.{(((((((((({.{{.{{.{{(((,,..))))).,,..,}........,..{{((........))))))))..)))))),..))))),,)))}))))))))))))))..{{{(((((..,{{{,((((..(((((((..(((((..(((((((((.{((((((.(((((((((........))))))))).)))))}{{,,...,,,...,,},...{{{,{({.,((((.(.(.(((((.....((((((.((((.((.(.(((....)))))).)))).})))))......))))).).).)))).,.}}},)}},}).)).)))))))..)))))..)))).)))(((.((((((((....)))))))).)))((((((,,,((((((((((....(((((((....)))))))....))))))))))...,))}))},}||{{{{,|...{{{{.,....,,((((((...((....,)}.)))))}......,.},,)))}.})))))))))),...)))}})))))))..)))).)))}}....}))..)))...)))).))).,}.))))).,)))}})}..)))....})))))).))))))))))).))),..).))))))),,.((((((..(((((..{(((((((..........)))))))}))))).))))))..........,)))))).,.,..})}}..)))),,))}}},{{(((,..(((......))).||,|}}.,,....}}}},.{,{{,.,|,{{{{||.(((((((({,,,(((({...(((((..(((((....(((((.(((........))).)))))..)))))...)))))))))).....,,...(((......)))(((((.{.......)))))......))).)}}})))})))))..{{{|||},.})})))},,,,.,,,....(((({{({{(((((((......)))))))..)),,.}}}))}}.,,,,,}||....}}))))).))))).)))))..)))))).,.,))))))))))))).)))))))))))))))))..(((((((((..(({.((((({....}.)))))}}),..))))))})))..,....,}}}..,))))))))).)))))))))))))).).))).))))...............{((((((.,.(((.((.........((((((((......((.,.((((((((.(((.,((........(((((((.....))))))).......))),))))))))))).),},.....))).))))),,,{..,,....|,.,,..,,)),...,((((((((....(((((((((,,..,,{{{{,,..|||.,,}....,{{{.....(((((((...))))))),})})))))))))..))))))))))))),)))))))))))))))))).))))).....,,,,,,....((((...))))......(((((((((((((.(......((((..........)))).....).)))))}})))))))..,{,(((((........))))}...,||||{{{{{,{{{{,...........|.,{{{.((((((((((((((((((((.........))))).(((((.((.((((.......))))..)).)))))..,.,{{({{...,,{,.,..,{||{,{{|,,.,..{{{{{|(({..||||{{........((((........))))......((((((......))))))......,,.{{{((({.({{,,.(((((.,......,.,,,.,...}}}..,))))}}}.}(((((((((.,.....))})))))))})))).)},|}|{||}|..{,{|,},...,,.))))},,})))))))))))))))}}))})}}}})),})}.|{({.((........)))))}..........,,.}.{{{{{{...}}}))).....,,|}}|||||,|{,,,,.{{{||},.,}}}}.},}),,.,,,,.

Transcripts

ID Sequence Length GC content
GCACUGCGAGGCGGGCCGCAGGGAGGGAGGCGCGAAGAGGGCGCGAGGG… 8059 nt 0.4978
GCACUGCGAGGCGGGCCGCAGGGAGGGAGGCGCGAAGAGGGCGCGAGGG… 8140 nt 0.4979
Summary

Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit of a voltage-gated non-inactivating delayed rectifier potassium channel. It is activated at the onset of myoblast differentiation. The gene is highly expressed in brain and in myoblasts. Overexpression of the gene may confer a growth advantage to cancer cells and favor tumor cell proliferation. Alternative splicing of this gene results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the KCNH1 transcript was identified as a nucleus accumbens shell (NAcSh)-enhanced target through a novel two-step topographic transcriptomic analysis [Crofton et al. DOI:10.1016/J.Neuropharm.2020.108398]. A study in mice demonstrated that spinal nerve ligation induced significant whole-transcriptome changes in injured dorsal root ganglia, where the KCNH1 was upregulated 5.90-fold six days post-injury [Wu et al. DOI:10.1177/1744806916629048].