Basic Information

Symbol
KCNH4
RNA class
mRNA
Alias
Potassium Voltage-Gated Channel Subfamily H Member 4 Kv12.3 Elk1 Potassium Voltage-Gated Channel, Subfamily H (Eag-Related), Member 4 Voltage-Gated Delayed Rectifier Potassium Channel KCNH4 Voltage-Gated Potassium Channel Subunit Kv12.3 Ether-A-Go-Go-Like Potassium Channel 1 Brain-Specific Eag-Like Channel 2 ELK Channel 1 BEC2 Potassium Channel, Voltage Gated Eag Related Subfamily H, Member 4 Ether-A-Go-Go K(+) Channel Family Member ELK1
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_012285.3
Sequence length
3788.0 nt
GC content
0.6188

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1619.30 kcal/mol
Thermodynamic ensemble
Free energy: -1670.69 kcal/mol
Frequency: 0.0000
Diversity: 654.71
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((....(((.(((((..((((((.(......((((...(((((((.(((((((((.(.(((((.((.......((((((((((((((((.((((((.((.((((....))))))))))))...((((.(((((((((((....((.((((((.........)))))).))((((....(((..((((((((((((.((((((((.(..((((((((((.((((((.........((((((........((...((((....))))...))((((((((((((...(((((....(.((((((....((((((..(.(((.((((.(((..((((((((..((((.((((....)))).((((...))))(((((........)))))))))..)))))........)))..)))))))..))).)..))))))((((...)))).....)))))))..)))))((((((((((((((((((.....(((....((....))..))))))))))...)))).)))))))........((((((........))))))))))))..))))))(((.((((((((...))))........)))).)))...))))))...((((((...)).)))))))))).)))))))).......(((((((......)))))))......(((.....(((((((........)))).))).....)))....))..))))))))).....))))).)))))))..))))))).....((((((..((...))..))).)))...((((((.((((....))))..))))))..))).))))))).).))))))))))))))...((((((((......(((((((((((((((((((...(((((..(((...(((((((..(((((((.(((((((.................))).)))).))))............((((((((......)))).))))...))))))))))..............(((((((.((((((.........((((....(((((..(((((((((((((.......((.(((((..(((.(((((..........)))))..)))..)...............(((((.(((...................((((((....(((((((....))).)))).......))))))))).)))))......(((((((.((((((((((((.(((....(((((((((.....).))))))))...)))....((((((..(((((((......((((((.((((..((((((((.(((((..((.((((.((((((((((((((.....((((((((.((((......)))).))))))))(.((((.........)))).)(((((((((((............((((((((((((((..((.(((((....((((((((((((..(((((((............))))........((((.((..((((((.......))))))..)).))))((((((....))))))...))).)))))....)))))))....((((..(((((((((..((((..((((((((((........).)).))...)))))...))))..).)))))))).))))((((..(.....)..))))..)))))))..)))))))))).))))..((.((((.....)))).)).)))))))))))((((((((((((.....)))))...(((........))).))))))).)))))(((.(((((((.((((.(((((.(..(((..((((...))))((..(((((.((((((.........))))))..)))))..))(((((((((((((((.((.(((...((.(..(((((((........)))))))..).)).))))).))))))....))))))))).)))..).))))).))))))))))).))).))))).))))))))))..))))).)))))))))))).)))))))))).)))..))))))....(((..((((.((((....)))).)))))))((((((........)).))))......(((.(((........))).))).((......)).))))))))))))))))))))))))).((.((((((((((.(((((......)).....(((((((((...)))).)))))))).))))))))))))....))))).))).)))))..)))))..))))..((((((((....((...(((..(((((((.(.(((((.((((..(((.((((((((((((((((((.........((((((((((....(((((((((.(((((((((((((((((((.((((...((((((((.((((......((((........)))).......))))))))))))((((((((((((....((((((((.((((..........))))))))))))..................((....))...........)))))))))))).....(((........))))))))))))))..))))))).))).((((((.......))))))...((((.....)))))).))))).)))).((((....)))).......)))))))))))))))))....))......)))))))))...)))...(((((((.((..(.((((((.........(((.((.......)).)))(((....)))..))))))).))...)))))))..)))).))))).)))))))).)))...))...).))))))).....(((((.....)))))..)))))))))))))..(((((((((((.(((((((..((((....((((((((..((((..(((((((((....))..))))))).))))..((((((((...((......)).))))).))).((((..(((((((.((.......((.((((((((((((((.((((((((((((...(((((((.((((..((.....)).)))).)))))))...)).)))))...((((((((...((((((((.(((((......................(((((((.......)))))))..........(((((((((((.................))))))...))))).))))).))))))))...).)).))))).((((((((((((((((((((((((((.(((((((((((((....)))))))).).)))).))).)))))))))..)))......)))..)))))))).........)))))..))).))).)))))))....).))........)).)))))))..))))...............((((((((((((......(((((((.....).))))))......))))))).)))))..))))))))....))))..))))))).)))....))))))))....((((........))))....)).)..))))).))))))))))...)))))))))....))))).)))......................)))))).......))))).)).).).))))))))....))))))).)))).......).))).))).))))).)))))).(((.(((((((...(((((((............................)))))))....))))))))))((((((((...))))))))....
Thermodynamic Ensemble Prediction
..{{{....(((.(((((..((((((.{......((((...(((((({,(((,,,((({({((({(.(({((..{{((((((((((((((((,((((((.((.((((....))))))))))))...{(((.(((((((((((...,((.((((((.........)))))).))((((....(((..((((((((((((,((((((((.(..((((((((((.((((((.........{(((((.,......{{...{{||,,,,})))...)){({{{||{{{((,..(((((....{.((((((....((((((..{.(((.((((.(((..((((((((..((((.((((....)))).((((...))))(((((........)))))))))..)))))........)))..)))))))..))).)..))))))((((...)))).....))))))}..))))}((((((((((((((((((.,,{,(({....,,,,..))},,},)))))))...))))},))))))........((((((........))))))})}))}..})}})|{((.((({((((...))))........}))),))},..))))))...((((((...)).)))))))))).)))))))).......(((((((......))))))),,....||{...,,({(((({.....,},))))}))).....)))....))..})))))))).,...))))).)))))))..))))))).....((((((..,,...,}..))).)))...((((((.((((....))))..))))))..))).))))))),}.)))))))))))))),..((((((((......(((((((((((((((((((...(((((..{((...(((((((..(((((((.(((((((.,,{.....,}}.....))).)))).))))............((((((((......)))).))))...))))))))))........,,,...(((((((.((((((.........((((....(((((..(((((((((((((.......{{.,,,,{..{{{.(((((..........)))))..}||,,}......}},,.....{,,((,{.({{{{..,,,..{{,.,,,.((((((....(((((((....))).)))).......)))))),,)})|}||,|||.((((((((.((((((((((((.,(({{,(((((((({,.{{{{|,,||}|}}|||}}}},...((((((..(((((((......((((((.((((..((((((((.(((((..((.((((.((((((((((((({.,,..((((((((.((({......}))).))))))))(.((((.,.....,,})}}.}(((((((((((...........,((((((((((((((..((.(((((.,,.((((((((((((..(((((((............))))........((((.((..((((({.{....}))))))..)).))))((((((....))))))...))).)))))....)))))))..,,,{((..(((((((((..((((..{((((,,{{{.,,.,...|,||.}}...,}))),..))))..},)))))))).))||((((..(,....),.)))),,)))))))..)))))))))).))))}.((.((((.....)))).)).))))))))))){{((((((((((.....)))))..,{||,,...,,{|||,|}}}))),))))))((.(((((((.((((.(((((.(..(((..((((...)))){{.,(((((.((((((.,.....,.))))))..))))),.}|(((((((((((((({,((.(({,{.((.{..(((((((........)))))))..}.)).))))).))))))..,,))})))))),)))..}.))))).)))))))))))}),..))))).))))))))))..))))).)))))))))))).)))))))))).)))..))))))....{((,.{(((.((((....)))).)))}))){(({{{........)).))))..,,..(((.(((........))).)))..},.}),))))))))))))))))))))))))))))).||,((((((((((.((({(......}},...|(((({((({...}))}.)))},))).))))))))))}}....))))).))).)))))..)))))..))))..((((((({....{(,..{{(,.(((((((,{.(((((.((((..(({.((((((((({((((((((.........((((((((((....(((((((((.(,(((((((((((((((((.((((...((((((((.((((.....,((((........}})}.,)),..))))))))))))((((((((((((....((((((((.((((..........))))}}}}),}},,.,..............,,.....}......}},,.)))))))))))).....(((........))))))))))))))}.,)))))).))),((((((.......))))),,,,((((.....)))))},))))).)))),((((....))))...,...))))))))))})))))}...,))......)))))))))...)))...(((((((.((.,(.((((((...,....||||,|||||....|},}||{{{....)))..}}))))}.))...)))))))..)))).))))).)))))))).))}...))...}.))))))).....(((((.....)))))..)))))))))))))..(((((((((((.(((((((..((((.{..((((((((..((((..((((((({(,...))..))))))).))))..((((((((...((......)).))))).))).((((..(((((((.||.......{,.,(((((((((((((.(((({(((((((...(((((((.((((..({.....}}.)))).)))))))...)).)))))...((((((((...((((((((.(((((......................(((((((.......)))))))..........(((((((((((.................))))))...))))).))))).))))))))...).)).))))).(((((((((((({(((((((((((((.(((((((((((((....)))))))).).)))).))).)))))))))..,)),,....}}}..)))))))).,{,,....}}))).,))),})).)})))},.,}})}))........)).)))))))..))))..,............((((((((((((......((((((({{...)}))))))......))))))).)))))..))))))))..}.))))..))))))).)))....)))))))).|,.((((........))))....)).}..))))).))))))))))...)))))))))....))))).)))......................})))))...}}},,,))).)).}.).))))))))..,}))))))),)))).......}.))).))).))))).)))}}}.(((.(((((((...(((((((............................)))))))....))))))))))((((((({...})))))))....

Transcripts

ID Sequence Length GC content
GACCGAAACGGCGCUGAGCCGAGCCGAGAGCUACGGGGUUCGGAGCAGA… 3788 nt 0.6188
Summary

Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. The gene is brain-specific, and located in the neocortex and the striatum. It may be involved in cellular excitability of restricted neurons in the central nervous system. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that spinal nerve ligation induced significant whole-transcriptome changes in injured dorsal root ganglia, with the KCNH4 being upregulated 4.02-fold six days post-injury [Wu et al. DOI:10.1177/1744806916629048].