Basic Information

Symbol
KCNJ10
RNA class
mRNA
Alias
Potassium Inwardly Rectifying Channel Subfamily J Member 10 Kir4.1 Kir1.2 Potassium Channel, Inwardly Rectifying Subfamily J Member 10 ATP-Dependent Inwardly Rectifying Potassium Channel Kir4.1 ATP-Sensitive Inward Rectifier Potassium Channel 10 Inward Rectifier K(+) Channel Kir1.2 Glial ATP-Dependent Inwardly Rectifying Potassium Channel KIR4.1 Potassium Inwardly-Rectifying Channel, Subfamily J, Member 10 Potassium Voltage-Gated Channel Subfamily J Member 10 Inward Rectifier K+ Channel KIR1.2 KCNJ13-PEN BIRK-10 SESAME
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002241.5
Sequence length
5205.0 nt
GC content
0.4749

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1625.50 kcal/mol
Thermodynamic ensemble
Free energy: -1722.83 kcal/mol
Frequency: 0.0000
Diversity: 1271.65
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((....)))((((((((((.....((((((...((((.(((.(((((...((((((...(((.((...((..((.(((((....((((((((((((((..(((((((...(((((((....(((((.((......(((...))).....)).))))).......(((.((....)).)))........))))))).)))))))..)))....).))))))........))))...))))).))..))..)).)))...))))))....(((.....).)).((((........)))).))))))))..........((...((((.(((.......))).))))...))(((((((...)))))))..(((((.(((((((((..(((((((((((((((.......((((....((((.((.((....)).)).))))...))))(((((((.....))))))).))))))).))))).))).(((((.(((..((((((((((...((((.......((.((((((((((((((..(((....))).)))).).))).)))))).))((((((((...((((((.(((((.....)))))..)))..(((((((....((((......))))..)))))))....)))..))))))))(((((((((.....))))))))).((.(((.(((((((....))))))).))).))((((((((((((.((.((..(((((.(((((((...(((........)))))).((((((((((......(((((((.((((((((((.(((((((((((.....)))((((.....((((...((((.((........)).)))))))).....)))))))))))).............(((((((..(((((((((((.((((((((....(.((((.((.(((((.((.....)).))))).)))))).))))))).)).)))((((((((((((((((((......((((((((((...))))).)))))....(((((...(((((....((((((((....(((..............)))...((((((..(((.......))).))))))....(((.((((.((......)).)))).))).(((((.(((((.((((((...(((.......))))))))).)).(((.....))).((((((((((.....((((((.((....(((((((.(((.((((....(((.((...((((((......)))))))))))....))))))))).)).))))).)))))).....))))))))))((((.((((.(.....))))).))))..))))))))..))))))))......)))))................(((((((((((((.........)))))).))))).)).)))))....)).))))))))))..((((((((((((.((....)).........(((.(((..........)))))))))))...)))))))...((((((...(((((...)))))))))))..)))))).))).))))))))))))..(((((((((((.(((.(((........)))))).)))..)))).))))..))))))))......)))))))))....)))))))))).............((((((((..((.(((...(((((((..((..((((....(((((((....(((((((.(((((((((((.....((.(((((..(((((((..((((....))))..)))))))))))).)).....(((..((((((...((((((((((((((((.........)))).....)))))))).............))))....))))))...))).....(((........)))......((((((((((((((((...(((((.((((.........................(((.........)))...((((..((((((.((((((.((((.(((....)))))))))))))...................(.((((((((((....((((((((.((((((((((((((((((((((...((((((........((((....)))).........((((((.........))))))............(((......)))....))))))...))))))).....(((....(((...((((((((((................)))))))))).))).....))).((((..(((...........))).))))............)))))))))))))))....((((((...((((((..(((((.((((.....))))...((((((((((.(((...((....))...)))..)))))))))))).)))....))))))..))))))..)))))))).))))).))))).).((((....((((((.....(((.((((((.(((..((((((((....))).)))))..)))...)))))).)))....(((........))).............((((((......))))))..))))))..))))......))))))..)))).)))).)))))))))((((......))))....(((((((((((((....(((((.((....(((......))))).)))))..........(((((((((((((((.((((((((((((.(((((((.((((......))))))).....))))....))))).(((.((((((((((.(((...))).))).))))))))))..(((((((.(((....))).))))))).........(((((((...((((((.(((.......(((...((((.((((((.......((..(((.((((........)))).)))..))....)))))).)))).)))...)))..))))))......)))))))((((((...((((..((((..((.....))..)))).))))...))))))........)))))))..........))))))...))))))))).....((((.(((........))).)))).......)))))).....)))))))..)))))))).))))..((((((((...))).)))))..............)))))).)).))))))))))((((((((((.(((.((..((((((..((((((((((.(.(.(((((((((((.(((.(.(((......(((((......))))).........(((.(((((((.((((.......)))).))))))).))).....((((((((((.(((......((((((((((((...((((......(((((((..(((((((..((...((((............((.(((..((((((((...((.(((((((((((((........((((..(((((((((...((((....(((.((((((((((.((((......))))..((((((.......(((....))).((((((....(((((....(((((.....(((((..((.(((((((.((((((.((.((((((.............(((.....)))..((((...))))...)))))).)).)))).((((....))))..))))))))).)).)))))......))))).)))))...))))))......))))))....)))))).)))))))....))))...)))))..))))..))))........))))))))).)))).)).)))))))).))).))............)))).(((.((((((((..((((........))))...)))).))))))).))..)))).)))..)))))))))))...)))))))).)))).....))).)).........))))))))..))).).)))))))))))))).).).))))))))))..)))))).)))))..)))))))))).)))))))))))..))..))))))).))).)).)))))))).).))).)))))))))))))))))))))........((((((((((((..((((..(.(((...((((((.(......)))))))....))).)..))))..))))))))))))))))))))))))))..))))))))..........)))))))).).)))))..)))).........((((((.......))))))))))))......))))))))))....((((((.((((.(((..(((.........(((.......))).((((((.....(((.((((((..(((......((....(((((............)))))....)).(((((.((((((((......(((((((...))))))).........(((((((.(((((.......))))).))))))).........((((...))))((((....))))..))))))))..)))))(((((.(((.((((....((((((((((((((......((((...((((...(((((....)))))..))))))))(((((.((.(((((....)))))))))))).......(((((((.....))).)))).)))))))))))))).....))))))).))))))))...)))))).))).........(((.(((.((....)).))).)))..))))))((((((((.(..(((((((.........))))).))..).)))))))))))..))).))))...))))))(((((........((((((((((((((.(((...)))....((((((((((.(((((.((((....(((((.((((((((((((.((....(((........)))...)).)))))............(((((.....)))))..))))))))))))(((((((((((.((((((....)))))).)))).....(((.((....)))))..(((((..(((((....))))))))))...((((((((...............((((......))))...........))))))))..)))))))..)))).))))).))))..))))))......))))))).........)))))))......)))))...
Thermodynamic Ensemble Prediction
...{{..,,|||.,{((((({..{(,,,.|{|||}}||{.,(((({{,,(...((((((...(((,((,..((.,((,({(((...,({((((((((((({,.(((((((...(((((((....(((((.((......{{(,..,})..,,})).))))).......(((.((....)).)))........))))))).))))))),.)))....}.)))))),.,,....))),...))))).}),.))..,).)))...))))))...})|})))..||||,((((.,,,.,,.|))},|||||({|,{{{..,,,,{,.{,{(((,(((((((({{({..,,))}....{((((({...})))))}.....(((((((((((,.{{((((((((({{{((,,,.,,,(({({(,,((((.{{,({,{,.||{||.,,,,}})))},,|||||{.,,,,)))))}),)))}))).))))).))).((((({(((..((((((((((...(((({......((.((((((((((((((.,{((....))).)))).).))).)))))).)){(((((((...(((,,{.(((((.....)))))..,,|{.(((((((....((((......)))),.))))))).}}.)))..)))))))}(((((((((.....))))))))).((.(((.(((((((....))))))).))).))((((((((((((,({,,{..(((({..{{.{{,..{(((........))))}}.((((((((((......(((((((.((((((((((.(((((((((({.....}}}((((.....((((...((((,((......,.}).)))))))).,,..}})))))))))).............(((((((..(((((((((((.((((((((....(.((((.((.(((((.{(.....)).))))).)))))).))))))).)).)))((((((((((((((((((...,,,((((((((((...))))).)))))....,,,,{{{(((((,...}}}}|||((((((...{(((((.{{,....,,,...((((((..(((.......))).))))))....|......|},...}).}))))).)))))}(((((,(({((.((((((,..{((.......))))))))).}},|{,.....,},.((((((((((.....((((((.((.,..({(((((.(((.((((....(((.((...((((((......)))))))))))....))))))))).)))}}))).)))))).....))))))))))((((.((({,(.....))))).))))..,,}))))}....,,||||......,,}}},,......,,......{{(((((((((((..,....,.))))))}})))).}}.}})))..,.})}}}))))))))..{(((((((((((,{{,{,{||.......................}.,))))})))))}..,)))))))...((((((...(((({...}))))))))))..)))))).))).))))))))))))..(((((((((((.(((.(((........)))))).)))..)))),,)))..))))))))......)))))))))....))))))))))......,,.....((((((((..((.(((...(((((((,{{(.,(({,,{,,(((({((,({(({{{,{.{((({{(({{{{{,...,|,|||{,.,|||||||..{{((,,,,|||}..|||||}||||}|{||{....}}))}.))))})))))}.{((({{{{{{{{,|,..,,},)))},,,,,)))})))},{(,,{{{{,({{({({{(((......}}}.}}}|..}||,....}}},,,,..({{{(((((((....)))))...{(({{.,((,...{{{.(((({.(((((({,{(((.(((((.,,,{{{{((,.,{{{..{{{{{,.((((((.((((.(((....)))))))))))))...............}}}}|}((((((((((....((((((((,(((((((((((((((((((((.(((..((.....,.{{{((({,...||||.,,,,,,.,,((((.....(((((((...({{.........{(((..,,,...)}}.))))..,.,.)))..))))))},,....))}}.}..(((((((((,....,,,,......,)))}))))))))))),..,))..))))))))).,{,,......))}.,,...,||...,,,..)))))))))))))))....{{{{((...(({(({,.(((((.,,.,..}))))}}},.|{{{{|{{{{..{(,,,((...,,.,,,||||.||}}}}}}}},,.)},}}},)))}}},,))))))..)))))))).))))).))))),|,{{(({,,,,({(((,,,,,(((,(({{(({({(..((((((((....))).)))))..)))),,||||||,|||,,,{{{.......{{|||{{.,.........((((((......))))))..}}||}}..|}||......}}}})}..)))).}}},,||||..,..((((......))))....{{{{{{{{(((((....{{{,|.||,...({{......})}||,}|||,.{{{{{,...(((((((((((((((.((((((((((((.((((,{{.((((......))))}}}.....))))....))))).(((.((((((((((.(({...,)).))),,)))))))))..(((((((.(((....))).))))))).........(((((((,,.((((((.({(,.....,((.....,,,,|||......{{{{((...,|}}}}}...{{{{{||,|,{,,.........)))))})))).,,....}))..))))))...,..)))))))((((((...((((..((((..((.....))..)))).))))...))))))........))))))).,,...,,..))))))...))))))))).....,{({.(((,.......))).))},.......}})))).....}}}}}},..||||||}||||||..{{{||{,{,,,))).))))),...,,{,........}}}}......,}}}}}}}}}}})}}},,.)))}||,).|))},.)))).}|}}}|}}}|,|}|||||}|}}}}}|}|}|}|,}|}||||{||||}.}}},,,},..,...,,||{.(((((((.((((.......)))).))))))).}})}}}}}((((((((((.(((...,,.((((((((((((...(({{.....,(((((((..(((((((..((....{((.{{{({{.....}})))}.}|(((((((...((.(((((((((((((........((((..(((((((((.,.((((....(((.((((((((((.((((......))))..((((((.,...,{({,....))).((((((....(((((....(((((...(((({{(..((.(((((((.,{((((.({.((((((......,,{|||,(((.....)}}..{{{,.,,))),,,.)))))).)).)))).((((....))))..,,))))))).)).))),,,}))..))))),)))))...)))))).....,))))))....)))))).)))))))....))))...)))))..))))..))))........)))))))))}}))).)).)))))))}.,.,.||,.......{,,|||||,({{.,|||||{,.,|||,.....,))}}||{{{|,,,..)))))).))..))))},))..)))))))))))...)))))))).)))),,...))).)).........)))))))).,)))})})).,||||||||||.....}))))))))..,}}||||{|,,.,..)))))))))).})))))),,)))}}},.))))))).))).)).)))))))),,,},..))))))}))))))))))))))....((({((((,,({{(((.,,((((((.(((.{(.(((({...})))).)}.))).))))))}}}},.,,..)))))))),,.)))))))))))))))..)}}}}}||,,{{......,,}}}||},,}},..}}}}))})},,}}},.{(((((.,....,))))))})),},))))))))))).({(((((..,.((((((((((({..(((,...,}}}.,)}},,{{{...)})))))).)))).,.....))))).)}..})))))))}.,,,...........{{{{{{{{{........}}}}})}||,,,......(((((({...))))))).}},.}}}|||||(((,{((((.......))))|{||,(((((........))))).}))).((((....)))).,}|||||||,,||,}}{((((.((,,((((....((((((((((((((......((((...((((...(((((....)))))..))))))))(((((.((.(((((....)))))))))))).......(((((((.....))),}))).)))))))))))))).....))))))).))))).||,|,}.}}}}})},,,,.....,{||,{||,||,...)),))),)))..((((({((((((((..{{(((((((.,.....,.))))).)}.}).)))))))).....,}))))),,,}}},||,(((((..,.....((((((((((((({.(({...}))....((((((,(((,(((((.((((....(((((.((((((((((((.((..,.(((........))).,.)).)))))............(((((.....)))))..))))))))))))((((((({(((.((((({....}))))).)))).....(((,((....}}}}}..{(((|,,(((((....))))}}}})),..{{{{{{||.....,,,.......((((......))))...........)))))}},..)))))))..)))).))))).))))}.))))))......})))))),........}))))))....,.))))),).

Transcripts

ID Sequence Length GC content
AUCUGAUCCCAGCUCCGGGUUUAAGAGUCCUGGCCCGGCCCGUCGCACA… 5205 nt 0.4749
Summary

This gene encodes a member of the inward rectifier-type potassium channel family, characterized by having a greater tendency to allow potassium to flow into, rather than out of, a cell. The encoded protein may form a heterodimer with another potassium channel protein and may be responsible for the potassium buffering action of glial cells in the brain. Mutations in this gene have been associated with seizure susceptibility of common idiopathic generalized epilepsy syndromes. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the KCNJ10 gene was downregulated in common in spleen leukocytes across all three injury models of trauma/hemorrhage, burn, and LPS infusion at the 2-hour post-injury time point [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005].