Basic Information

Symbol
KCNJ2
RNA class
mRNA
Alias
Potassium Inwardly Rectifying Channel Subfamily J Member 2 IRK1 Kir2.1 LQT7 Cardiac Inward Rectifier Potassium Channel Inward Rectifier Potassium Channel 2 IRK-1 HIRK1 Potassium Inwardly-Rectifying Channel, Subfamily J, Member 2 Potassium Channel, Inwardly Rectifying Subfamily J, Member 2 Potassium Channel, Inwardly Rectifying Subfamily J Member 2 Potassium Voltage-Gated Channel Subfamily J Member 2 Inward Rectifier K(+) Channel Kir2.1 Inward Rectifier K+ Channel KIR2.1 HHBIRK1 HHIRK1 ATFB9 SQT3
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_000891.3
Sequence length
5391.0 nt
GC content
0.4075

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1517.20 kcal/mol
Thermodynamic ensemble
Free energy: -1619.89 kcal/mol
Frequency: 0.0000
Diversity: 1318.64
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....((((..(((((.((((((((((...(((.....)))(((((((((..(((...(((((....(((((((....(((......))).....))))))).(((....((((......))))....))).)))))...(((((((...((((........))))...))))))).....((((((((.((.((((.((....)).)))).)).((((....))))(((((((.........))))).))..(((((......)))))..........((((((((((((((((((((..(((((...(((((.(((.(((((((..(((((((.((((((.(((((((((....((....)).((((.....))))..((((.(((((((.(((.(((.......)))))).)).))))).))))....))))))))).)).)))).((((...))))..)))))))..))))))))))((((..((......))....))))..((((.(((((..((((((((......)))).))))..))))).)))))))))....))))).)))))..((((((.(((((((.(((((.((...........)).)))))....(((((((((((((...........((((((((..(((((((((((.((((((((.((((((((((.(((.(((((((((((.....(((((((.((...)))))).)))......((((.((.((((((((((((.((((....(((((....)))))....)))).((((....))))....))))..)))))))).)).))))...(((((((..((((((.((((((((((((....(((....)))...))).))))..))))).(((((...))))).))))))..)))))))))))..)))))))..))).)))))))))).))....(((((....)))))(((((((......))))))))))))).))..))).((((((((((((((((((((((((....((....))....)))))).......)).)))).)))))))))))).(((((((((((((....)))))..(((((.....))))).(((((...((((.......(((((((...((((.(((((............))))).))))))))).)))))).)))))........((((((......))))))..))))))))....(((.....((((.(((.............))).))))..)))))))))..))))))))))))))))).).)))....))))))).)))))).(((((((((((((...(((....(((((((((((((((((.((.((((((((((((((((.((((((((((.(((((.((..(((((......)))))..)))))))...........))))))))))...((((.......................))))....((((.((((((((......)))))))).))))((((.........))))....((((((((....(((....))).....)))).)).)).((((....((((.................))))...)))).(((((.((.(.(((((((((.((((....))))))).......((((((.((((......))))))))))...........))))))..).))))))).(((..((.(((((....))))).))..)))((..(((((((((((....((((((...(((..((..(((((..((((((...(((((.(((((...((((.((((((((.((.....)).(((.(.((((((..(((((.((....))))))))))))).))))....))))))))))))....))))).))))).......)))....)))..)))))...))..)))))))))....)))))))))))..)).)))))))))))))))).)).))(((((......)))))....((((((......))))))((((....(((((.....((((((((....(((((........)))))....))))))))...)))))....))))......((((((........))))))..)))))))..))).......)))))..((.((((((........))))))))....((((.(.....).)))))))...)))))))))))))......(((((((((((.((((((.((((((((((((((..((................((((((((.((((...((((((((((......((((((..(((..(((.(((((((...((((((.((......)).)))))).........))))))).)))......)))..))))))...........))))))))))...)))).))))))))(((....)))(((.(((.....)))...))).((((((...((((((...))))))))))))................(((((((.(((((.((........)).))))).))))))).....))..)))))))..)))))))...........)))))).)).))))))))))))))))))))).)))....)))))))).)))..)))))).))).)))))))))))))))..))))(((((((((((.((.((.((.(..............).)).)).)))))))))))))..............((((((((.(((.........(((((((((.(((.((((....((((....))))....)))).)))..........((((....))))((.(((((.......(((((((((..((((((.((((.....(((............)))..)))).....)))))).)))).....((((((((((.((..((((..((((...)))).))))))))))).)))))))))).......))))).))..)))))))))(((.((((.((((((((.((((((((((......)))))))((((((((...(((.((.((((........))))(((((((((((.(((((((.....(((((((.((.((.....)).))...)))))))........((((((.(((((.((.((((((........))))))))))))).)).)))).....((((((.((...(((.((((.(.((((((..((((.((((((.((((((((((.((..(((((.(((...)))))))))).)))))...((((..(((.....)))..)).))........((((((((((((((((..(((........((((((.........................)))))).....(((((.((.(((((((((((((((.(((((.((.(((((.(((.((((.(((((..(((...((...(((((((((((((.((((........(((.((((.(((((((.(....((((((((....))))))))....)..))))))).)))))))........)))).)))))..((((((..........)))))).((((((((((.(((....))).))))..))))))(((((......))))).............))))))))...))))).))))))))))))))))).)).))))).))))..(((((((....(((((((..((((((((.(((((((...(((((((((............(((((((((..((((((((((((((.((((((((((((((.((((.(((....)))....(((((((((.(...).))))).)))).......)))).)))))))...((((..((.....))..))))((((...((....))..)))).......((((((((((.((.(((..(.((..(((((((......))))).....))..)).).))).)).)))))))))).((((((((.(((((....)))))..))).)))))(((((((((((((((.((((((((.....(((((((.((..((((((.(((((...))))).)))))).)).).......))))))))))))))...((((.(((((...(((.((((((.(......).))))))))))))))))))((((((.(((((((((..(((((....((((((...........))))))(((((.(((...((((((.....))))))))).)))))......((((.(((((....))))).))))..(((((((.................)))))))(((((.....((((((((.............)).))))))))))).....)))))..))))))))).)))))))))))))))))))))))))))).)))))))))))))).....(((((((((((((......))).)))))..)))))...........(((......)))(((((((((((..((((((.((....))))))))..........)))))))))))......((((((((((.....)))))))))).)))))))))))).))))))...)))))))....((((..(((..((((((((.((((((((((((.....(((((..........))))).....))))))))))).)..))))))))..))).))))........((((.((((.(((((((((((((((.............)))..(((.((((....)))).))).((((......))))...(((((.((((.((((.......((((((....))))))........)))).)))).))))).)))))))))))).)))).)))).....))))))))..)))))))...)))))))...)))))............(((((.(((.....))))))))..)))))).)).)))))...........((((..((((((......))))))..))))......(((((...((((....))))...)))))...(((((((((......)))))))))...........)))..))))))))))))))))(((.((((........))))))).(((((...((((.((((........)))).)))).....))))).....)))))))))))..)).))..))).)))).)))))))...)).)))))).......)))))))....)))))))))))..)).)))....)))))))).......))))))))..))).)))).)))..........))).))))))))((((((.......))))))..................
Thermodynamic Ensemble Prediction
.....((((..((((({((((((((((.,.((({..,.|||{{|{{.{{|||{((...{(((,....(((((((....(((......))).....))))))).,((,...((((......))))....))}..,}},...(((((((...((((........)))}...))))))).....((((((((.((.((((.{{....}}.)))).)).{(((....))))({(((((,......,.))))).)}..{((((......}))))..........{(((((((((((((((((((..{((((...(((((.{((.(((((((..(((((((.((((((.(((((((((....((....)).((((.....))))..((((.(((((((.(((.(((.......)))))).)).))))).))))....))))))))).)),,))).((({...})))..)))))))..)))))))))}((((..({......})....))))..((((.(((((..((((((((......)))).))))..))))).)))))))))....))))).)))))..((((((.(((((((.,{(((.((...........)).)))||{,..,,((((((((,(({{,.....,}}||,|||||.}||,,{{||||(((((((((,,(,(((({((({(((,(((((((((.....(((((((.(((((((..,((((((({,,...,,(({{,..||}}}}})))))((((....(((((....)))))....)))).})))))).)))...)))))}||}||,{{{|||||||{{{{{{(((({,,,{,({(({({((,,{((((({{{{((({,,{|}}..,))|{||||.,||||}.(((((...))))).}))))},}))))|||||||||||}}}}}||||,.}))))}}}||,||,...(((((....))))){{{{{{{...,,,))))))))))))),)}}))))}((((((((((((((((((((((((....((....))....))))))}......}},)))),}))))))))))).(((((((((((({....}))))..(((((.....))))){(((((...((((.......{((((((...((((.(((((............))))).))))))))),}})))).))))}.,......((((((......))))))..))))))))....,,)).)}}|,|{.,||,|,|,}}}}}}}})))}))),....,)))}))}}))),))))}}))}))))})}))}....))))))).)))))).(((((((((((((...({(,,{.{{{,||||(((((((((.((.((((((((((((((((.{(((((((((.(((((.,{,.{((((......})))}..}})))))...........)))))))))|,,.({({,.,..,,.....,.........,}}}}....((({.((((((((......)))))))).})))((((.........))))....({((((((....(((....))).....)))).)).}|,,{,{,,,.{(((,,.,.{{,,..,.....}}|}...}}}}.{{{||.|,||,{{{(((,,,.,|||..,,||||}}}...,,,,|(((({{((((......))))))))),...........)))))),.)})))),))}{{{..{{.(((((....))))).)).,)))}|..,,{|{(({,,,....,||||,,,,|||{((({{((..({.,...(({{{(({...(((((,,.((((.((((((((.((.....)).{{,{(.((((((..(((((.((....))))))))))))).))}}....)))))))))))).,}.))))){{{{{{.,.....})))))))))}})),,...})..))))))))||{{{{.,,,,,.)))))},..)))))))))))))))).)).)}(((((......)))))....((((((......))))))..,,...,(((((.,{,.((((((((..,,(((((........)})))....))))))))..,}}}}}.......,.,,,,.((((((........))))))..)))))))..}}|{{,,,,,}}|||..{{.((((((........))))))}}....|||{.{....,),)))))}}...))))))))))))).....,((((((((({(,{(((({,(((((((((,,,,,}}||}}}}},..........((((((((.((((.,.((((({{{(({({{{.((((((..(((.,(((.(((((((...{(((((.((......)).)))))).........))))))).)))......)))..)))))).........}))))))))))).,.)))).)))))))),|{....,||(,(,{{{....{|||{,..,,.((((((...((((((...))))))))))))......}}}}}}....{((((((.(((((.((........)).))))).))))))}.....,,.,))))))}..}}}}}}}...........}))))).))}}))))))}})))))))))))).))}....)))))))}.}},..,}})}}}))).)))))))))))))))..)))){((((((((((.((.((.(,.({{............)})}.)).))))))))))))}...........,,.((((((((.{{{,,....|||{((((((((.(((.((((....((((....))))....)))).}))..........((((....)))){{,((({({,......(((((({,..,|}|||.}}}|,.}}}|,,..{{{,.,,...)))}}),,|{{{..||}))).|}|......((((((((((,{,..((((..((((...)))).))))})))))).)))))|||....)))..}))})})}..))))))))){{{.((({.((((((((.((((((((((......)))))),((((((((...(((.{{.{(((........)))}(((((((((((,(((((((.....(((((((,((.((.....)).)).,,)))))))........((((((.(((((.((.((((((........))))))))))))).)).)))).,,..((((((.((...(((.((((.(.{{{(((..(((({((((((.((((((((((.((..(((((((({...})))))))}).)))))...{{((..(((.....)))..)).})...,,,..{(((((((((((((((..(((.,,,,,..((((((.,,...............||...,.))))))..|||({({(.((.((((((,,{{(((((.{((((.{{.(((((,(((.((((.(((({,.(({.,,{(...((((((((,,,{(,((((,,,.....{({{((((.(((((((.{.,{,{(,(((((....))))),)).},,,..))))))).)))))||,,,{((({{{.{(,|.||..((((((........}.)))))).||,,,|,||,}|||}}}.}})})))},{|}}},}||||,,,},.,})}}),,,...,,.....))))))))..,})))).))))))))))))))))).}}.))))).}||},.{((((((.,..{((((((..((((((({.((((({(..,(((({{||,........{{,{(((((((({..{(((((((((((({.{{(({{{...,|,||||}}}{{(....))}....(((({((((.{...}.))))),}))}..{{,..,,{{,({{(,((((,,....}|||..}}}}.,},}.,}|}....{({{{,...)}.,.......((((((((((.((.(((..,.((..(({((((......|}}}}.....)}..}),|,))),}).)))))))))).(((((((({(((((,...}))))..}},.}}}}}{(((((((((((((({((((((((.....(((((({,,...((((((.(((((...})))).))))))....},,.,...))))))))))))})...,,{{.(((((.,{{{,,(((((,......,,},)}}}}}}},))))),||{((((((.(((((((((..(((((....((((((...........))))))(((((.(((...((((((.....))))))))).)))))......((((.(((((....))))).))))..((((({{....,{...........))))})|(((((,....{(((((((..,.......,..)).))))))))))),....)))))..))))))))).)))))))))})))))))))))))))))).)))))))))))))}|,...(((((((((({({,,....})).))))}..)))))...........(((......)))(((((((((((..,{{{((,(,....}}}}}}}}..,,,,....)))))))))))......((((((((((.....)))))))))).)))))))))))).}))))),,.})})))),,,.((((..(((..((((((((.{(((((((((((..,..(((((..........)))))..,..))))))))))).}..))))))))..))).))))........((((.((((.(((((((((((((((,.{{{,.,....,,))},,{{,|(((....)))}.}}}.,,||,,....}}}}...(((((.((((.((((.......((((((....))))))........)))).)))).))))).}))))))))))).)))).)))).....})))))))..))))))}...))))))).}}),},,.,,,,,,.,,,,||{||,,||,....)},)))),..)))))}.}}.})}}}...........,{{|,,{{{{{|......)))))),.},,,......(((((...((((....))))...)))))..,{((((((((......))))))))}...........)))..)))))))))))))))}{|||((((........)))),,,.{{{((.,,{{((.{(((.,,.....)))).)))}.....}}))),....)))))))))))),})},)..))).})),,)))))))...)).))))))..},...})))))}..,.))))))))))}..)).)))....))))))))......}))))))))..))).}))).)}},.........,}}.)))))))|{(({((,,.....})))),,...........,}},..

Transcripts

ID Sequence Length GC content
AGAGCGCACUGGAGCCCUGGCCAGCGCGCAGCCUUCCCGGCGCCGGCGG… 5391 nt 0.4075
Summary

Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, probably participates in establishing action potential waveform and excitability of neuronal and muscle tissues. Mutations in this gene have been associated with Andersen syndrome, which is characterized by periodic paralysis, cardiac arrhythmias, and dysmorphic features. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human cardiac tissue demonstrated that the KCNJ2 mRNA is upregulated at least threefold in cases of mechanical asphyxia-induced death compared to control groups including craniocerebral injury and hemorrhagic shock, with this upregulation being independent of age, postmortem interval, and environmental temperature, indicating its utility as a biomarker for this cause of death [Zeng et al. DOI:10.1007/S00414-017-1616-4].