| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGAAUUUCAACCAGAAAGAACAGCCAGUGCAAAGGCCCAGAGACAGGA… | 1903 nt | 0.6311 | |
| GGGAGCGGCGCGGGACGGCCGGGACGCGCGGAGACCCCAAGACCCACGC… | 2065 nt | 0.6552 |
Several different potassium channels are known to be involved with electrical signaling in the nervous system. One class is activated by depolarization whereas a second class is not. The latter are referred to as inwardly rectifying K+ channels, and they have a greater tendency to allow potassium to flow into the cell rather than out of it. This asymmetry in potassium ion conductance plays a key role in the excitability of muscle cells and neurons. The protein encoded by this gene is an integral membrane protein and member of the inward rectifier potassium channel family. The encoded protein has a small unitary conductance compared to other members of this protein family. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the KCNJ4 was significantly downregulated (0.10-fold) in injured dorsal root ganglia following spinal nerve ligation, as identified through whole transcriptome RNA sequencing and validated by quantitative real-time PCR [Wu et al. DOI:10.1177/1744806916629048].