Basic Information

Symbol
KCNJ6
RNA class
mRNA
Alias
Potassium Inwardly Rectifying Channel Subfamily J Member 6 GIRK2 KATP2 BIR1 G Protein-Activated Inward Rectifier Potassium Channel 2 HiGIRK2 Kir3.2 KCNJ7 Inward Rectifier K(+) Channel Kir3.2 GIRK-2 KATP-2 Potassium Inwardly-Rectifying Channel, Subfamily J, Member 6 Potassium Channel, Inwardly Rectifying Subfamily J, Member 6 Potassium Channel, Inwardly Rectifying Subfamily J Member 6 Potassium Voltage-Gated Channel Subfamily J Member 6 Inward Rectifier Potassium Channel KIR3.2 KPLBS
Location (GRCh38)
Forensic tag(s)
Wound age identification Drug abuse diagnoses

MANE select

Transcript ID
NM_002240.5
Sequence length
19659.0 nt
GC content
0.4136

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-5517.90 kcal/mol
Thermodynamic ensemble
Free energy: -5896.23 kcal/mol
Frequency: 2.54498e-267
Diversity: 4312.50
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((.((((((((((.((((((.....)))......))).)))))((((....))))(((.((((((((...((((.(((((....))))).)))).(((.(((((.((((((((.....(((((((.....(((((.........))))).(((((.(..(((.((((((((((((.(((((...(((((((((..(((((....((....((((.(((.((((((((((((....((((....((((((((....(((((......((((((..(..(((.(((....))))))..)..)))))))))))))))))))))))))))))))))))...(((((...((((....(((....)))..)))).....))))).......((((...((((.....(((((((..(((((((((....(((.((((.((.((.(((((((((.((((..((((((((..((((......(((.(((((........))).)).)))....((((((.((((((.(((...))).))))..)).))))))(((....))).......))))..))))))))...))))))))))))).)))))))).)))((((......((((.(((....))).))))((((((((((........))).)))....)))).(((......)))))))......(((....)))(((.(((.....))))))....))))))))))))))..))......))))...))))..))).)))).))...)))))....(((..((.....))..)))....))))))))).(((((.........)))))..............)))))..))))))))(((.((((....)))).))).((((.((((........))))))))........)))).)))..))))))...............)))))))..)))))))).))))))))((((((.((.((..(((.(((.......(((((.(((((((((((((((((((..((((....))))....(((((....)))))((((((....))))))(((((((...((....(((((((......)))))))....)))))))))(((((............((((..((((........))))..))))............))))).))))))))))))))...((((((((((((((..(((.((.....)))))))).)))))))((.((((((......)))))).))))))...((((.((((((...)))).)).))))....)))))..)))))...))).)))..)).))..))))))((((((((.(((((((((((..(((........)))..))).))).)))))(((((((((.(.(((((((((.(((..(((((...)))))..)))...............((((((.((((((...............)).)))).))))))))))))))).))))))))))(((((((.((((((((((.....((.((...)).)).((((...)))).(((((((((((........((((..((((.(((((((..(((((((((........))))))))).....(((((((.......)))))))((((.....))))......((((...........))))......((((((.......)))))).(((((....))))).((((((.(.(((....)))).))))))...........))))))).))))...((((..........)))).........)))).......)))))))))))......(((((((........((.((((((((((.....))))...((((((((((((.((((((.....(((((.((((((.((((..(((((((((((((..(((((((..(((((((.(((((((.((((((.......((((((((....(((.......))).....))))))))..(((((((........((((((.....))))))..))))))).))))))..)))).))).)))))))((((......).)))....(((((.((.((((................(((.....)))(((((.(((((((((.....(((((((.......(((((((..(((......(..(((((..((.......))..)))))..)......))).)))))))........(((((((.(((...))).)))))))(((((((((((...(((.((((((((....(((((((....(((((((...)))))))....)))))))(((((.((.(.((((.(((.....)))..............((((((.........))))))....((((((((...((((((((...............((((....))))..((((((((((.((((...(((((((..((((((((((...(((....)))..)))))))..((((........)))).............................)))...))))))))))).)))))))))).((((((.((((......((.(((((......(((((((..((((((...(((((((...(((((((((.(((..((.((((((((((..(((.((......)).)))..))((((.(.......).))))...((((((..(((..(((..(((.(((((((((.(((.((((((...(((((..((((...(((((((.(((((((...((((....))))..((((((((...)))))))).....((((.........))))(((((((..((......((((..(((.......)))..))))(((..(((((((......)))))))....)))((....))..(((((((......................))))))).)).....)))))))..(((((.....)))))(((.......))).))))))).))))))).....)))).))))).....)))((((...))))....((((((........))))))......))))))))))))))).)))..))).))))))))).(((.((.(((..(((.((((((......(((...((.....((((((((((.....((((((..(....(((((((.(((.......)))...))))))))..))))))((((((.....)))))).)))))))))).....))....))))))))).)))..)))..))))).)))))))).))...)))..))))))))).....(((..((((..(((.((((.........)))))))..))))..)))((((((((.(((((((((((((((..(((((((((((((((((((..((((.........((((.........(((((((.......(((.........((((.((((((((((((.(........))))))........((((.(((((......((((((((((((((((((.(((....((((((...........)).))))...............(((((.....))))).....(((((((..((((..(((.....)))...)))).))))))).(((((((......(((((((..(((.....((.(((((((.((.(((.((((((....((((.((((((((...........)))..))))).)))).((((.((.((((((.............)))))).)).))))......)))))).)))))))))))).))..((((....))))..........((..((((....))))..))...(((((((((((...((((.(((((((((((((((..(((.((......)).)))............)))......)))))))))))).)))).)))))((((.............)))).....(((((((((((((((((....)))...))))))))))))))....))))))......)))..)))))))..((((((.(((((...))))).)))))).(((((.(((((.............(((((((((((((..((....((((((.............))))))....)).))))))...)))))))))))).)))))...)))))))((((......)))))))))).)))))))))))))))..(((((((((..(((..((((((.(...(((((((..........((((..(((((.(((((.....)))))....))))))))))))).))).).))))))..)))..)))))))))....((((((((.((((.(.(((....))).))))).))))))))(((..((......))..)))..))))).))))(((((.............(((((((((...(((.((((......((((((((.........)))).))))..(((..(((((((...((((((..((......))..)))))))))))))..)))...(((((.(((((((..((((((.((((((((......(((((((((((((((((((......)))))..............((((((......)))))).))))))..))))).)))...................((((..((((..............))))...)))).......((((((...))))))((((....))))...........)))))))).))))))..(((((....)))))(((..(((((((((...((((.....((((((((((...(((((((((((.(((((((...((..(((((.......((((((((.(((((...((((((.((...((((......)))).(((.(((.......)))))))).)))))))))))))))))))....))).))..)).))).))))..))))))).))))...............(((((((((....)).)))))))...................)))))))))).....................(((((..((....))..))))).))))...)))))))))..))).......)))))))..))))).........(((......))).)))).))).))))....)))))...........)))))(((((..................))))))))))))..)))))))......)))))))((((....)))).........(((((........)))))..)))).........))))..))))).))))))).................(((...........))).(((...))).(((((((((..(((((........)))))..)).(((.(((((((((.(((.....((((.........))))))).))))))))).....)))...((((((((((((......((((...((((((..(((..((((............((((((((((................(((((.(((.(((...........))).)))))))))))))).)))))))))))...))))))))))))))))))))))(((((((.(((((...(((..((.(((......)))))..)))..((((((((((.(((...............))).))))))))))..........))))).)))))))))))))))))))))..))))))))))))((((((((((((((((((((((.......((((((.(((((((..(((((((((((((((((.(((((....((((....((((((...((((.....))))(((((((...........)))))))......))))))....))))..))))).))..))))))....))))).)))).........(((((((.(((((...(((...............)))....))))).)))))))(((((((.((((....)))))))))...)).))))))).))))))..(((((.........))).)).....)))))))))))))))))..)))))......((((((.((.(((((..(((((((((........)))))).............((((((((.(((((((((...))).(((((....(((((((.(((((................))))).(((((......(((((.(((..(((((.(((........))).....(((((((((..(((.(((((((((((((((((((.........))))))).............))))).))))))).))).....(((((........)))))((((((......))))))...((((.........))))............((((((...((((((((((((((((((((((.((((.......(((((.(((.......))).)))))...(((((((((((.........(((((((((((.(((((..................(((((((((((((.((((...))))...))))((((((.((........)).))))))((((((((.((((.((((((((((..(((......................)))..))))))).(((((((..((...((((...............))))....))..)))))))...........((((((((((((((((((((((((....)))))))...)))))))).....))))))))).(((((((((..(((((...........)))))))))))))).))))))).)))))))).((((((((......))))))))........)))))))))...))))).)))...)))))))).......)))))))))))(((((((.....))))))).........(((((.((((.(((.............)))))))((((((((....))))))))...((((((((.....))))))))....)))))....(((.((.((...)).)))))...))))..)))))).)))))))......(((..((......))..)))...(((((.......)))))(((((((((.......)))))))))......(((((..(..((((((...(((((...(((((..(((((((((......)))))...))))..))))))))))....))))))..).)))))..((((((((...(((((.......)))))....))))))))......)))))))))))))))...)))))))))......(((((......)))))..........)))))..))).))))).....)))))...(((((((((.((........)).))))))))))))))))....))))).....(((...((((((.....))))))...))).((((((((..(((....)))....(((((((((.......)))))).)))..)))))))).)))))).)))))))).....((((.(..(((..((((.......))))..)))..)))))..........((((((((((((((((..((((..((((((((..(((((((...........((((((.....)))))).((((((((((((((..(((((.....(((((.(((((..(((((.(((((((..(((((..(((((.((((((((.(((((((.((((......))))..((((.(((....))).))))..(((.....)))....................((((((((((((((((...)))).))))))))))))...(((((..(((((.......)))))..))))).))))))).)))))).)).))))).............((.....))((((...(((((.(((.........))).)))))..)))).....(((((.........)))))(((((...........)))))........(((((((........))))))))))))...))))))))))))..)))))))))).(((.(((((............((((.((((((((((((((((........))))....................(((((((((.((((.((((....(((((((((.......)))))))))..........((((((((((.(((.......))).))))).......)))))..........((((.(((((((.((((((((((.((.(((((((.(((....((......((((((.....))))))....))....))).)))).....))))).))).......(((..((((((((..(((....)))..(((.((((......))))))).......((..(((((.((((((...((..(((((.........((((...........))))........((((...(((...(((((((.......))).))))((.((((((((((.............((((((.((....((((.(((.(((.....((((.(((((....))))))))).....)))))).))))..))))))))((....)).((((.(((((.((((((((....((((........)))))).))))))...))))).))))....)))))))))).)))))...))))...(((((......)))))...)))))..)))))))))))))..))..)).)))))).)))....)))))))))))))))))).((((((((.((((...(((((...))))).((((((((.((((((.....))))))((((.((((((((...((((((..................))))))....)))))......))).))))((((.....(((((((((.((.(((((.((....)).))).))))((((.((((...)))).)))))))))))))......))))......)).))))))..((((((((....(((...)))...))))))))...((((.(((((........))))))))).......((((.(((......))).))))..................)))).)))))))).((((((((............)))))))))))).)))).)))))))))....((........)).............)))))).))))))..)))).......(((((....)))))))))).))).((((((.....((((((..((((((.((.((....)).)))))).))))))))......))))))))))).))))))))))))))..((((((((...................(((((.((((..(........)..)))))))))..))))))))...(((......)))((((((((....)))))))).((((((((.((.((.((((((((((((((((((((((((((((((.(...((((((.(((((.(((((((((..((((((((((((((..((((.((...((((((((..((((((((((..(((((((((((((..(((((.((((.(((((.(((((.((((((((((((.((((((((((((((((((..((((((((((((((.((((((.(((((((.((((..((((((((((((((((((((((((((((((..(((..(((((...((..(((((((.((...((((((.........((((((((((..((((((((((((((.....(((((((((((((((...(((((((((((...(((..(((...((((.(((..((((.((((((.((((.(((((....((((..((..((((.(((.(((((.((((.........(((((((.......(((((((((((((((.((....(((((.....((..(((((((((..((((...((((((((.......................((((((........).)))))(((((...(((((((.....)).)))))...))))).....(((((...(((.((((((.((...)).)))).....)).))).)))))..........(((((((..(((((.((.(((.(((((......))))).))).........((((.(.((((........)))).).)))).(((((((((((((.....((((((((.....................))))).))).........((((.((...(((((.....(((((((((((((((((((((....))))))))))).(((((.(((((((...((....))..))).))).)...)))))))))))))))....)))))......)).))))....((((((.(.(((((.......((((((((((((((((((((...(((..(((((....))))).))))))))))).))))))........))))))(((((.......))))).(((((........)))))....))))).)))))))...(((((((.(((.(((((((((((((.((((((((((((((((((......(((((((((((........(((.(((...((((.((((..(((((...((((...((((((((((((......((((((((((((..((((..((.((((((((.((((.....(((((......)))))((((((.(((..((((((((((....(((.(((......))))))))))).).)))))))))))))))))))))))))))))))..))))))))).)))......))))))))((((((((....))))))))...))))...))))...)))))...((((....))))(((.((((..((((((((((.((((((............)))))))))).)))))))))).....))).........((((........)))).....................)))).))))..))).)))((((((((............(((((....)))))........(((((((((((((((((((.((((..(((......((((((.................((((((((((((((...((((..((((((((((....))))))(((((.((((((((((((......((((((....))))))...((((.....))))........(((((((....))))))).(((((((((.((((((.((((.........)))).))))))((((.........))))........(((((((((((....(((.((((((.(..(((((..(((((......)))))...)))))..).)).)))).)))..((((.....(((((((((((((..............(((((....(((((((((..(((((.............((.(((....))).))..))))).))))...))))))))))((((((.(.((((((((((.((((..(.((.((..((((((..(((((..((((((((.((((....)).))))))))))))))).......))))))...))..)).)..)))))))))).....((((((((((((((((((((((..(((((.....)))))..((((((((....)))).(((((.................(((((......(((((...)))))..)))))............(((((............)))))...(((((((((((....((((((((((.((((..((.((((...........))))......(((((.(.((((...))))).)))))...........(((((.(((((((..((........))..))))))).)))))....))..))))(((((.((.((((..(((......(((((((((...)))).)))))...))))))).)))))))..........))))).)))))..............))))))))........)))..)))))))))...(((((.((((.....((((((((......((((((...((((((........................))))))..................(((((............)))))..((((....))))....(((((((((((((...................(((((((.((((((........)))))).............(((((..........))))).....((((((........))))))...((((((.((((..........)))).......((((...((...((((..(((((......)))))(((((((((((((((......))..........((((((........................))))))....(((((((..........((((...((((((((((((.(((....)))((((((((........................(((((.((..((........)).)).)))))...............................(((........)))........((((((((((..(((((.((((((......((.((((....................(((((.((((((((((((((.((((.....)))).)))))...))))....))))))))))..(((((((......)))).)))((((((((((((...(((..((((.....)))).......((.(((((((((..(((......))).))))))))).))................(((((((((..............))))).)))).....(((((...........)))))...))).)))))))))))).....(((.(((((((((((.((((((((((((((((......))))...((((((..........((((((....))))))..(((((.(((((((((...((((...((((......))))...))))...)))))))))..))))))))))).....((..(((((((.....((.((((((..(((..(((..(((.....(((.....)))....))).)))..)))((((((.((((......((((...........))))......)))).....))))))...((((..........))))......((((((..........)))))).....(((((......)))))...)))))).))..)))))))..))......))))))))))))))))))))))).))).......(((.((((.....)))))))...(((((......)))))..)))))).....)))))).)))))..........))))))))))..))))))))(((....)))(((((.....))))).......((((((.....((((....))))..(((((((((((((((...((.....))...)))))))...)))))))).......((((((((((....))))..)))))).))))))((((((((...((((.((.(((((((.....))))..))).)).))))((((((((((((((......(((((...........)))))((((.(((......))).))))(((((....)))))........))).)))))))))))..))))))))))))))))....))))..)))).(((((..((((((((...............))))))))..))))))))))))........(((((.......)))))..))))))).)))))).......))))...)).))))...)))))).(((......)))...)))))))....((((.((.(((((..........))))))).))))(((((...........))))))))))).)))))))....((((((((.((((...((..(((((((((((.((((......)))).)))..)))))...)))..)).)))).)))..........)))))))))))......))))..........))))....)))).))))).(((((....))))))))))))))))))))))))))))))).).)).))))....((((.((....((((((.....))))))(((((...))))))).))))..))))))))).).)))...)))).((((((((.(((......((.(.(((.(((.....)))))).)))....)))..))))))))....))))))))..)))................((((((.((((((...................))))))))))))..(((((.......)))))...(((.(((.((((..((..(((((((((....((((((((((((((((((..(((((.(((((((.(((((.(((....(((((...)))))....))).)))))...)))).........))).)))))..))))).........)))))).)))))))....((((((((((((((((((..((((((((.....)))).))))..))..))))).)))))).)))))......................(((((..(..((((((((((............))))))))))..)..))))).............))))))))).))..)))).))).)))))))))))).)))))))))))))))))..(((..((((......))))..))).(((((((((...))))))))).....(((((...)))))...))))..))))..)))))))..................(((((((((((((((.(((((..(((((...))).))..)))))...))))))).))))))))..............))))))).((((((.((((...))))))))))(((((.((......)).)))))......(((((((..........((((.....))))(((..((((((...))))))....))))))))))..))))))......)))...)))).)))))........))))))))).))))).....((((...........))))(((((((((((((.................))))))))))..)))............))).)))))..((((.......)))).)))))))))))......))).))))))))....((((((((((.((((((.((..........)).)))..))))))))))))).)).)))))..))))..))))))))).))))))))))....))))..)))))))))....)))))))..)))))))......((((((....((((..(.(((((((.(((.........))).))))))).)..))))....)))))).....((((((....)).)))).....))))))))))))((((((.(((((((........................(((((..(((.((((((((((((.....((((......))))...)))))..)))..........)))).)))..)))))(((((((..........)))))))......................................(((((............)))))...))))))).)))))).......)))))))))..))....))))))))))))))))))))))((((.(((...((.(((...))).)).))).)))).)))))))..........)))).))))).))).)))).))..))))...)))))..))))..(((((........)))))......)))))).)).))..))).))))...)))..)))..))))))))))).)))))))......((((.((((....))))))))....))))))))((((.....))))....((..((((((........((((((.((((((((...............)))).)))).))))))........))))))..)).....))))))).))).))))....))))))))))(((.((((.........)))).))).........((((.....))))..))))))..)).)))))))....))..)))))..)))..)))).(((((.......)))))(((..........))).)))))))))))))))))))))))))).)))).))))))).)))))).))))))))))))))..)))))))))))))))))).)))))))))))).))))).))))).)))).)))))..)))))))))))))..))))))))))..))))))))...)).))))..))))))))))))))))))))))).))))).))))))...).))))))))))))))))))))))))))))))..)))).))))))))(((((....)))))...............(((((............(((((..(((......)))...))))))))))(((((..((((............))))..))))).)))))))................))))))))..))))..))))).....))))...)))))))...........((((.(((..((((((..((((((..................(((((..(((((.........)))))...))))).......(((((.(((((((...))))))).))))).......(((.((((((((((((..............(((...)))(((((.((..((...............))..)).))))).)))))))).)))).)))))))))..))))))....)))))))....(((((((..(((((((......)))))))......))))))).((.((((((((.((((...............)))).)))).))))..)).(((((....)))))...........))).))))).)).))))))....(((..............)))))).))))))))....)))))))..)))))))).))))).....))))).)).....))))))))))....((((((((((((....(((((((...............)))))))....((((..((((...(((((.((((((((((.(((((.....(((....)))..((((((((.......)))))))).(((....)))..(((...(((.((.(((.((((((..(((((((.(((((....(((((......((((((.......)))))).....)))))....)))))))))))).)))))).))).)).)))....))))))))..)))...)))))....)).)))))...))))..))))))))))))))))((((((((.((.((((((.(((((((........(((((.(((...(((((..((....))..))))).........))).)))))))))))).)))..))).)).)))...)))))..))))))))...))))))))....)))).).)).))))))))))))))))..)))))))))))....((((((((((...(((((((..((((....................((.(((.(((......))))))..))....((((..(((((......((((((((((..((((...))))((((...(((((............)))))..))))...))))..)))))).........)))))..))))..(((........))).))))..)))))))....((((....))))...(((((....((((((......((((.(.((((((((..((((.(((...................((....))............((((.(((..((((..(((((.....(((((((.......))))))))))))))))))).)))).)))))))..)))))))).).))))....(((.(((..((..................))..))).)))....)))))).)))))..((((...)))).....)))))........(((((...)))))..............)))))(((.(((........))).)))...)))))))))))))))))))))...(((((......)))))....)))))))))))..........(((((((((....(((((.(.....).)))))((.((((((((..............(((((((...((((.(....)))))....)))))))...)))))))).))((((((........)))))).(((((((.(.((....)).).))))))).)))))))))....)))))))..(((((((.(..(((((((.((.((((.............)))).))..)).)))))..)))))))).......))))))))))))))))).......((....)).((((.((((..((((((..(......)..)))))).)))).))))...)))))).))))))))))).((((.(((.(.(((((((.((((..((((.(((.(((((.((.(((((.(.....).))))))).))))).))).))))..)))).)))))..)).).)))))))...........((((((....((((...))))......))).)))...(((((((((....)))))))))....((((((.....))))))...(((((((..(((....)))......(((((((.((.((...(((((((.((((.((.....)).))))...((.(....))))))))))..)).)))))))))...........)))))))..........((((....)))).....))))))))...))))(((((....))))).............)))))).)))))))))(((((......(.(((((...))))).)...(((((((............))))))).....))))).....(((....((((((.((((((((..(((((.....)))))..))))))))..)))))))))....)))))))))).))))))).((((((...(((((((((((.((((......)))))).)))).)).......))))))))))).))))))..)))))))).))).....((((((....)))))).))))).))))))...(((((((((.((.......)).)))))))))...............(((((((((((..........(((.((((((((....)))))))).))).....((((.(((((..((....))....))))).)))).((((((..((.....))..)))))).....)))))))))))......
Thermodynamic Ensemble Prediction
((((((.((((,(((((.((((((.....)))......))).))))){(((....)))|(((.((((((({...((((.(((((....))))).)))).(((((((((((((,(((({{{...,((((({.,((((((..........{{{{(((((.((((,.{{,,{(.((((((((.(((((...(((((((((..(((((..,.,(,...((((.(((.((((((((((((....((((....((((((((,,.,((((({.{{{.(((({{..{..|||,||{},,,))||||{.}..}))))))})),))))))))))))))))))))))))...(((((...((((....(({....}))..)))).,...))))).,.....((((...((((....,((((((({.,((((((((...,(((.{{{{.{(.{{.((((((((((((((..((((((((..((((......{((.{{(((........))).}).))}....((((((.((((((.(({...})).))))..)).))))))(((....))).......))))..))))))))...))))))))))))).}}}}||||,|},{{{,......((((.(((....))).))))((((((((((........))).)))....)))).,||||,,,,,,,||}},...,,||{....|||((,((((.....))))))....))))))))))))))..)).,....))))...))))..))).)))).))...)))))...,(((..((.....))..))}.}}.))))))))).(((((.........)))))..............)))))..)))))))).}}...((((...{(((....)))).))}}...{((((((((,(((..{,.((((..((((((((((((({{,...........{(|{(((,,.{(({,{{{,|,|{||{..{{,,,.}}.,))))))))}..},|{{{|....)|}||,{((({((,,,......,,,,..}}))))}.},|{|{,....})))).,})))))))))))))..)))).,}..))).,(((((({......))))))}...((({{....))))))))},))))}..((((((((......)))))))),.,{,...,,,,..........,}}))))))))))))},||||||{{(((((({((.,(((,{(.....}})))))).))))))}{(.((((((..,,,.}}}}}}.))}}}|.,})).....((((...)))).(((((......)))))..{(({{.....,.,,,||{|{||,|}}{||||}|{{((,,(((((((((((..(((........)))..))).))).)))})||||||||.{(((({,,((((.(((..(((((...)))))..))).,,,..,,}})))}.{(((((((((((((((..(({...((((.{.{(,.....)),,))))...))).)))).))))))))))}.}}||}}}.{|||{(((((((...(((....(((,.,{{{(({,,,,,...,},}}}.{{{|,|||||||{,.(({,...|||{|{{{{,,,,,,,.))))}||||{{...(((((((.......)))))))...)))}))}.,)))....)))...)))))))..}||||.....((((((.......)))))).{||||,,,,)}))),|{{{{,,|,|||,...}}}}.}}}))).....}})))))}...,)))))....((({.{.{{{{(.{|||,...,,{,,,...{{(((((((((.((((.({((((((((((.......)))}.(((,,.{.((((((.((((......((((({,|,,{,(((({{....,{((({.((((((,{(((..(((((((((((({.,(((((((,,(((((((.(((({{(,{{(({{.......((((((((....,((,......}})}}...))))))))..(((((((,.......((((((.....))))))..))))))).})))))..))),))}).)))))))((((......).)))....{|{{||{{,{{{{...............,{({.....)))|{{{{{(((((((((,..,{((,(((((((....{{{{,{{.,{{{......}}||||||..,{,,,...,||{||}|||||,..(((,({{.,|||(((((,.....(((((((.(((...))).)))))))(((((((((((...(((.((((((((....(((((,{....((((||{,,,|||||||,{.,||||}||,{{||.||,|,|||{.{,|||},}},,..,,|,..,}.,}}|{{{((,,.......))))))....,(((((((...((((((((...............((((....))))..{(((((((((.((((...(((((((..{{((((((((...{{{....}}}.,)))))))..((((........)}}}..........................,},))}...))))))))))).)))))))))}.((((((.((((....,,({.(((((......(((((((..((((((...(((((((.,.(((((((((.(((..((.(((((((((,..(((.((......)).)))..,,((((.{.......).))))...((((({.{(((..(((,.,((.(((((((((.(((.((((((...(((((..((((...(((((((.(((((((...((((....)))),.((((((({...}))))))).,..{((((.........))))|((((((,(((({,...((((..(((.......)))..)))),,..,{((((((......))))))}.....|.{{....)),}{((((((...........,,,.......,))))))}..,.....)))))),..(((((.....))))){((,,.....))),))))))).))))))).....)))).))))).....)))((((...))))....((((((........))))))......))))))))))))))).}))..)))}))))))))).(((.((.(((..(((.((((((......(((.{{(,....,((((((((((.....((((((..,,,,.{((((((.(((,....},)))...}))))))),.)))))}((((((.....)))))).)))))))))},,...),}}).))))))))).)))..)))..))))).)))))))).))...)))..))))))))).....(((..((((..(((.((((.........)))))))..))))..)))((((((((,(((((((((((((((..(((((((((((((((((((..((((..,,,,...,,||.........(((((((.......{{,.........((((.((((((((({(({(........}))))),.,{,,,,((((.{{(({......((((((((((((((((((.(((.,{.((((((...........)),})))......,........(((((.....))))).,...(((((((..((((..(((.....)))...)))).))))))).(((((((....,,(((({((.,(((..,,.((.(((((((.((.(((.((((((,{..((((.((((({({.{,{........))},))))).)))).{(((,((.((((((.............)))))).)).))))..,,,.}))))).)))))))))))).},..((((....)))).,.....,,,||..((({....}))),,|}...{((((((((((...((((.(((((((((((({({..{((.,,......||,,,,.,,,........)))......)))))))))))).)))).)))))|({(,...,........}}}||{,..(((((((((((((((((....)))...))))))))))))))....}))))|......)))..))))))}..((((((.((((,...})))).)))))).|||{{.,||||},.....,,,..{(((((((((((((..{{....((((((.............))))))....}}.))))))...))))))))}}}}.))))}...)))))))((((......))))))))))}))))))))))))))).,(((((((((..(((..((((((.,...,{(((((,,,{{,{,.,({((..{((({.(((({.....)))))....))))))))))))),}}).).))))))..)))..))))))))),...((((((((.((((.(.(((....))).))))).)))))))).,,..((,,....,,..))},.})))),))))(((((,{.......,.,.((((((({(...(((.((((......((((((((.........)))).))))..{((..(((((((...((((((..{,......},..)))))))))))))..))}...(((((.(((((((,{((((((.((((((((...,..(((((((((((((({{{((,,,,,.}}}}}.,|,,,.,......((((((......)))))).))))))..)))))}}))...........,,,,,,..((,,,.{{((..............)))).}}))))......,((((((...))))))|(((....))),...........)))))))).)))))|..(((((....))))|(((..(((((((((...((((.....((((((((((...(((((((((((.(((((((.,.,{..{{(({.......((((((({,(((((...(((((({({...{(((......)))},({(,(({....,,.))})),)).)))))))))))))))))))....}},.}}}.}).))).))))..))))}}))))))...............(((((((((....)),,))))))...................)))))))))).......,,........,.,.(((((..((....))..))))).))))...)))))))))..))),.,,}..))))))),.))))).........(((......))).)))).))).)))}...,)))))...,.},.,,.)))))(((((..................)))))}))))))..)))),,..,.,,.)))))))((((....)))).........{{{{{.....,..)))}}.....,,........))))..))))).))))))).................(((...........))).(({...})).(((((({(({{(({{(........}}}},..}}.....(((((((((.(((.....((((.........))))}}).)))))))))...}})))}..((((((((((({......((((...((((((..({,.,((((,...........,{((((((((...........,,...(((({{(((.(((..,........))).)))))))))))))).)))))))))))...))))))))))))))))))))))(((((((.,((((..,((,..{{.{||,.....}}|||,.}},..((((((((((.(((.,,.........,,.))).)))))))))),,,,,.....)))),.)))))))})))))))))))))..)))))))))))){(((((((((((((((((((((...,,,,((((((.((((((({,(((((((((((((((((.(((((.{{.((((....((((((...((((.....))))|((((((...........))))))}......))))))....))))}}))))).))..))))))....))))).)))),,.......(((((((.(((((...{{{.........{.,...})),...))))).)))))))({{((({,((((....)))))))))}..,,..)))))).)))))}..(({(({{,....,}))).)).,,,,))))))))))))))))}.,))))},.....((((((.((.(((((..(((((((((........))))))..................{((((({,(((...{{{((((.{{{{..{((((,,,.(((((....,,.....,,...)))))}}|||,.}....,||||}}},..|||,|}||}},......}||.....{((((((((..,{,.(((((((((((((((((((.........))))))).............)))}),))))))).|||,.,,.((({{....,,.,))))),{((({......}))}}|,,.((((.........)))).,,.........((((((...((((((((((((((((((((((,(((({......(((({.{{{.......}}}.}))))...(((((((((((.........(((((((((((.(((((..................(((((((((((((.((((...))))...)))){(((((.,({{,.....))})))))|((((((((.((((.(({{((((((.,(((,......|||,,..........}}}..))))))|.(((((((..({...,,{{.,.{.....},....))}}....,,..)))))))......||{{{(({{((((((((((((((((((((....))))))),,,}}))))))..,,,))))))))),(((((((((..(((((.,,.....,,.)))))))))))))).))))))).)))))))),((((((((......))))))))........}))))))))...))))).))),..}))))))).......)))))))))))(((((((.....)))))))}},,},,..{{{{{.((((.(((...,.....,...)))))))((((((((....))))))))...((((((((.....))))))))....||||}....(({.({.,,...}}.)))))..,)))}..}))))).))))))}....,.(((..{,......},..)))...(((((.......)))))(((((((((.......)))))))))......(((((..({.((((((...{{(({...(((((..(((((((((......)))))...))))..)))))}},,)}...))))))..),)))))..((((((((...(((((.......)))))....)))))))).,....)))))))))))))))...)))))))))......(((((......))))).{{(((((({.|{{({({...{(({,,,...||||....{((((((((.((........)).))))))))},},}},,((((((......)))))),|{{{,{(,,,,,|||||,{{|||...,|,||({|.{((....||}...}(({{((((,..{{,.{||||||{|,|.,{{{|{|.|{|{{,.,.,})}})}.}}}}}|||,,|}}|||}}||||....}}}))))..}},,}}}))},,,,,.....{(((((((((((((((..((((..((((((((..(((((((...........((((((.....)))))}.{(((((((((((((..(((({.....(((((.(((((..((((({(((((((.{((((({.{{(((,{(((((((.,{{{{(({((,({{,...},},..{(((.(((....))).))))}}||)}},..,))}})))...............((((((((((((((({...}))).))))))))))))...(((((..(((((.......)))))..))))).,,}}},|{|||||,.},,)))))}........,{{,((.....)),{||,,.(((((.(((.,......,))).)))))..,,||,,..,(((({.........}))}}.|}}},....}},,...,}}}........{((((((........)))))))))))).}.))))))))))))..)))))))))).{{{.{{{{(...,,,,,,..,((({.((((((((((((((((........}}}}..,{,,.....,,,......(((((((((.((((.(((((,,.(((((((((.......))))))))),,,,....,,({{{{(((((.(((.......))).))))}.......|||,,..,,,.....((((.((((((,{((((((((((.((.(((((((.(((.....{,.....((((((.....))))))..,.,,....))).)))).....))))).))).......(((..((((((((..{({,....,...(((.((({.....,))))}}}.....{{((..,(((({((,,,.}}}||}}||||{.......,,{{{{,{{,.......||||.......}}}|,..,|{{{{{..,,{((....}}},,,.)))}|..{(((((((((.............(((((,,((....((((.((({(((...,.((((.(((((....))))))))).,.,}))}))).))))..))))))))((....)).((((.{((((.(((((({{...,((((........)))),)}})))))...)))),.))))....)))))))))),{{,.,.}})}}}...{{{{{......)))))..,}}}||..|||||}},))))),,)),.)).)))))).)))....)))))))))))))))))).((((((((.{(({...(((((...))))).((((((((.((((((.....)))))),(((.{(((((((...((((((..................))))))....))))),.....))).))||((({.....(((((((((.(((....))},.,..,,...,.},||((({.((((...)))).)))))))))))))......}))),.....})}}}})}}..((((((((,{..(((...)))..}))))))))...|{{|.{{{{{........}|||||}}}.}}},,.((((,(((......))).))))...,|{{{..,.......,))),)))))))).,(((({{{............)))))))))))).)))).))))))))),,,,,,,,,,....},..........,,.)))))).)))))).,||||,,,,.,,({{{{..,,)})))))))).)),,(({{{|.....((((((..((((({,((.((....)).)))))).))))))))},,,..))))))})))).)))))))))))))|,.((((((((...................(((((.((((..(........,..)))))))))..)))))))).||(((......)))((((((((....)))))))).((((((((.((.((.((((((((((((((((((((((((((((((.{...((((((.(((((.((((((((({,((((((((((((((..((((.((...,(((((((..((((((((((..(((((((((((((..(((((.((((.(((((.(((((.((((((((((((.((((((((((((((((((..((((((((((((((.((((((.(((((((.((((.,((((((((((((((((((((((((((((((..(((..(((((...((..(((((((.{({..((((({.,,,,....((((((((((..((((((((((((((,,,,,({((((((({((((((({((({{((({({,.,{((((,(({..(((({((({{(,((.{((({,,((,,{(({,,{{,{(((({,{{({({{{{({{{((({({((({{((.{{{{.{{{,{{{..,{..(((((((((((((((((((....(((((.....((..(((((((({..((((...(({(((((.........{{,..,,......{((((({,.....|,|.}})))|{{{{...{({({{{.....)).))))}..,))))),....(((((...(((.((((((.{,...,}.))))..,,.)))))..)))))..........(((((((..((((({(,.(((.(((((......))))).))).......{.{(((.(.((((........)))).).)))),(((((((((((((,..{,((((((.{,..,,,,............}}))),,})),}}}},....((((.((,..(((((.....(((((((((({((((((((((....}))))))))))}{{,,,.,{,{{{(,..((,,.,|}..,}}.})),.,}}))))}))))))))))....)))))......)).))))....((((((.(.(((((...,...((((({((((((((((((((...(((..(((((....))))).))))))))))).)))))).{{....,)))))){((((.......})))}.(((((........)))))....))))).)))))))...(((((((((((.(((((((((((((.(((((({(((((((({{(,{{...((((((((((({.{{,{{,(((.(((...((((.((((..(((((...((((,{{((((((((((((......((((((((((((..((((..((.((((((((.((((.....(((((......)))))((((((.(((..((((((((((....(((.(((......))))))))))).).)))))))))))))))))))))))))))))))..))))))))).)))......))))))))((((((((....))))))))...)}))}}.))))...)))))...((((....)))){{{.((((..{{(((((((,{((((((,(,.......)})))))))))).)))})|})}}.....,)),.,,.....((((........)))).....................)))).))))..))).})),|||}.........,,,...{{{{{....}}}||,{,.,,..{((((((((((((((((((.((((..(((......((((((..,{{{,,,,{..,,{{{(({,{{(((((((...{(({.{(({{((((((....)))))),{{{{.{(((((((((((................{{{{,,..,}}||,,...((((({...}))))),,,........,..({(((((((((.((((((.((((.........)))).))))))((((.........))))..,{,....(,((((((((.........((((({...((({{..(((((......)))))...,)))){{(((,..,,{{{.((((((((....)).)))))).|||.....})}}}....((((({...,((((((((..(((((..,,....,,...,(,(((....}))}))..))))).))))...)))})))))){,,{,{{({(({(,,(((({((({,.({((,,{..((((((..(((((.{{(((((((.((({....,).)))))))))))))))..}}},.}})))){.{|{{.||{|{{|,,,))))),.....((((((((((((((((((((({..({{((,,...}}}}}.{((((((((,...|||,..{{((,........,,,.....(((({......(((((...))))).,))))).,,..,.,{...(((((............)))))...,|{((((((((..,.((((((((((.((((..(,.((((...........))))|,.,,.(((((.(.((((...))))).))))).,.,,..,,,.(((((.(((((((..((........))..))))))).))))).}},}},,))))(((((.({.((({.{({(,.....(((((((((...)))).)))))...))))))).)))))))..........))))),))))}...........}..)))))))},.......,,,.}))))},||,,|||((((,,{{(,,...,((,{(((......((((((...((((((........................))))))...............,.,((({(,,,.........})}},..||||.,,,))}}....(((((((((((((.,,........,.......{((((({.((((((........)))))}.....,...,...{((((..........))))}.....{(((((........)))))}{{{(((((({((((..........))}}.......,,,{.......,((({.{(((((......)))))|{((((((({{((((,,....}}.....,....||||||..........|,{{,.{,,{{{,,||||.......,,{{{,.....,},,.((((,.{((({(,,({{{{.(((....}}},,,,{{({,.......................(((((.{{..,,........,}.}}.)))))...........,...................(((........)))........((((((((((..(((((.((((((......((.((((.{{,,,.....({{.....{(((,...|||||||{{{{||,||{|||,,,||}},||||}...}},,},}}))))))}}}},{(((((((......))))},))||((((((((((...{((,.((((.....)))).,,,......{((((((((..{((......))).))))))))}.,|,............}}.{({{(((((..............))))).}))}.....(((((...........)))))...,.,.))))))))))}}.....(((.(((((((((({.((((((((((((((,,....,{||,,...,,,,{,....,,|{{{((((((..,,||||}}.,|||||.(((({{{({,..{(((,..({{(......|}}|,{.|}}}...}}}}}}}}}..}}}}||||,|}.,...((..(((((((.....{(.((((((..,,,..{{{..(((.....(({.....}))....))).)))..},.{{{(({.((((....,.((((,,,,...})).))))......))))..,..||}}}}...((((..........))))......{(((({,.....,,..}))))).....,((((......))))}...)))))).))..)))))))..))....})))))))))))))})))))))))).))).......(((.((((.....)))))))...(((((......))))),.)))))).,...)))))).)))))..........))))))))))..}})))))){{{,{,.||,,,{{{.,,..,}}}},.,,,}}|,||}},,.,,{{{{....)))},.(((((((((((((((..,(,.....,,.,,))))))}..,))))))))....,,,{{{{{{({{{{,,,||}}.,}}}))}.,,}}}}|||{,{{||,,.,,}})}}}||..|},}}})},||{|||,...,))}}{(((((((((((((......(((((...........))))}((((.{((......))}.))))(((((....)))))........))),))))))))))).,}))))))}))))))))....))}}..,)}},{{{({..((((((((...{.......,...))))))))..}}})})))))))........(((((.......)))))..)))))))}}))))}.......}}},...)),}))),..)))}},.(({......))}...})))))}...,((((.,,.|||||..........|||||,,,},....,,,..,,,,,....}})},))))))))))))))..,,..,,((((.((({.{,((..(((((((((((.((((......)))).)))..)))))...)))..)),)))),}}}....,,.....}})}))))))......}})).))...,.,.))))....)))),)))}}}|{((|....)))))))))))))))))))))))))))))))}).),,||||....||||},{,.{(((((((.....)))))))|||....,}},}))})}},,.)))))))),.}})))}.})))),((((((((.{({......,(,(.(((.(((.....)))))).))),...))}..))))))))....)))))))),,}}}.....,,,,.......{(((((.((((((.{(,............}),))))))))))))..,{{||,,.....}}}},...(((.(((.((((..{{..(((((((((....((((((((((((((((((..(((((.(((..{{.(((((.(((....(((((...)))))....))).)))))...,,}}.........))).)))))..))))),........}))))).)))))))....(((((((((((((((({(,.(((({(({.....}))).))))..))..)))))}}})))).)))))...........,,..,......(((((..(..((((((((({........,...})))))))))..)..))))).........,.,.))))))))).}}..)))).))).)))))))))))))}))))))))))}}}}}},,{((..,{,,....,,))}}..,,,.(((((((((...)))))))))....|{{{{,.{{|,.....,},})}}))}}..))))))}..,......,,.......(((((((((((((((.(((((..{{(((...})).}}..)))))...))))))).))))))))..|||..,.....||}}}}}},((((((.((((...))))))))))(((((.((......)).)))))..,,{{..,|}}},..,,,,,}}}|,,..}},}}}{(((..((((((...))))))....)))),,,,,,..))))))......)))...)))).))))),.......})))))))).))))),,.|,||||...........}}|},|{((((((((((...,{.....,}.....))))))))}),,||}|.........{.|||........,.}})))}...)).),)))))))))))...,,.))},))))))))....(((((((({{{((((((.((..........)).)))..})))))))))))).}).))))).}})))..))))))))).))))))))))....})))..)))))))))...,)})))))..)))))))......((((((....((((..(.{((((((.||||||,.....))),))))))}.)..)))}....)))))).....(((({{....}}.))))|,,..|}}}}}}))))),(((((.(((((((.....,{,................(((((,.,,,.,,{{{(((((((.....((((......))))...)))))..}}}.......,{{||||{||,..||||,(((((((..........)))))))...}}},.,.}},...,}}}}}},...,,,,,,,....{((((............)))))...))))))).)))))}.......,})))))))..))....))))))))))))))))))))))).,|.{((...((.{{{...|},.)),))).,|{{{||||,,,.,}}..))},)))).))))).))).)))).))..))))...)))))..)))).....)))))..)))..))))..,,.)))))).)}.))..))).))))...)))..)))..))))))))))).))))))}.{{{.(((((.(((.,..(((((.,.(((((...{....}.,..))))).,.))))),,,.))).))))).})},{(({{,(({,,{{{{|.........,...,})},)))).,}}))),}.}}}}}.,},.}}))......))))))).))).))))....)))))))))){{{.((((,,,,.....}}}).))),........{({{|...,})))..})))))..)).)))))))....))..)))))..)))..)))).,((({.......})}}}{{{...,......}}}.)))))))))))))))))))))))))).)))).))))))).)))))).))))))))))))))..)))))))))))))))))).)))))))))))).))))).))))).)))).)))))..)))))))))))))..))))))))))..)))))))}...)).))))..))))))))))))))))))))))).))))).))))))...}.))))))))))))))))))))))))))))))..)))).))))))))(((((....)))))......,,,{{,..{(,{{{,,,..,,}}..,(({{{..{{{......)))...)))}),.,},{((((..((((..........,.))))..))))}.)))))))................))))))))..))))..))))).....)))}...})))))),,,.....}},)|||}}))))}.}}))))))},,|,,....,,,,{{{.....(((((,.{((((....,.,,.))))),..,}})),,,,,..{(((({(((((((...))))))),)})}}......{({{,(,((.((((((,.....((({{.{{{...{{{|...,((((..((.({.{((((............))))),,)},)),,)))})))).))).)))))..|,,)))}}}.)),})))}}..(((((((..(((((((......)))))))......))))))).|{.,|||{{{{.{{{{,..||.....,,...)))),)))).}}}}.,}}.(((({....}))))....,,,....))).))))).)).)))))),,,,({{........,,,...}}}))).))))))))...,)))))))..)))))))).))))).....))))).,,...,,))))))))))....,{((((((((((....(((((((...............)))))))....((((..((((...(((((.((({{,{{{,,{,,,.......,{||{{((({{{{{((({,....,,,)))))))).,,,..,,||},,.,|...{{{.{|.(((.((((((..(((((((.(((((....(((((...(((((((((.......))))))}))).)))))....)))))))))))).)))))).))).,,.,,}....,,..{{||..||....,,}},...,))})))))...))))..))))))))))))))}|((((((((.((.((((((.(((((((........(((((.(((,.,(((((..((,,,.}}..))))}..,}}}}},))).)))))))))))).)))..))).)).)))...)))))}.))))))))...)))))))}....}}}).).))}))}},)))))))))))..)))))))))))..,,((((((((,((.,(((((({..{{{,....,.,,,.|||,|||,..,,...,,{(({{,..,,,.{((,,((....((((..(((((......((((((({((..(({,...|)))((((...(((((............)))))..))))...)))).,)))))).........)))))..))))...}})}}}....,,)}))))..))))))),}.}||||,.,.))}}...(((({....((((((......((((.(.((((((((..(((,{(((,,........{{,,{{,..((....))...|,,|||,..{{{{.{{|..((({..((({,...,((((((((.......)))))))))))))}))))}.)))}.}))))))..)))))))).).))))....(((.{{(..((.(.....,........,.})..})}.))}....)))))).}))))..||||}},})}},,.,,,.}}}.}}}}}}}|||{{...}})),......{,(({,......)))).{,,.....,,,}}}.||{.,,,,,.)))))))))))))))}}.{,{((((......)))))}..,)))))))))))......{{..(((((((((....{{{{{.(,,,..,.}})))|(.((((((((.......,...,,.{((((((...((((.{....}))))....))))))}...)))))))).)}((((((........)))))).(((((((.(,{{....)).,.))))))).)))))))))..}})})))))..(((((((.(..((((({{.((.((((.,{,...,,,...)))).))..)).)))))..)))))))).......})))))))))))))))).......((....)).{(((.((((..((((((..(......)..)))))).)))).)))}...)))))).})))))))))).((((.(((.{.(((((((.((((..((((.(((.{((((.({.(((((.(.....).)))))}}.))))).)),.))))..)))).)))))..)).}.))))))}......{({.((((((....{{,.,..{({{......}))}.|}|...{((((((((....))))))))},,.||{{,,,.....,,,,|||..(((((((..,{{....|||..,,..(((((((.((.((...(((((((.((((.((.....)).))))...{{.,....}},)))))))..)).))))))))),,}}}......)))))))..,,.........,..,,||||{{{{{|{{{{|||{{{|{||{{,{{.,,.|},,,...................{||||||...||,|,,,,...,.{{{{|,,.))))).}...(((((((..,,.....,,.)))))))...{{||{||.....|||.,}}{{{{{{.{||(((({..(((({..,,,)||}},,|)}})))),.))))))),,.}}}}}},,..)))))).})}.))))))....)))).)))))).}..,.})))))))).).,,,))))))))))))))),))))),)..})}...}))))))).))),....((((((....)))))).})))).))))))...(((((((((.({.......)).))))))))).........,.,{{.(((((((((((..........,,,.((((((((....)))))))).}},.....((((.(((((.,({....))....))))).)))).((((((..,,.....))..)))))).....))))))))))).}}}..

Transcripts

ID Sequence Length GC content
GCUUUUAUCUCGGAGCCGCGUCGCUUCGUGCGCUGCCAGCGGGGCUCAG… 19659 nt 0.4136
Summary

This gene encodes a member of the G protein-coupled inwardly-rectifying potassium channel family of inward rectifier potassium channels. This type of potassium channel allows a greater flow of potassium into the cell than out of it. These proteins modulate many physiological processes, including heart rate in cardiac cells and circuit activity in neuronal cells, through G-protein coupled receptor stimulation. Mutations in this gene are associated with Keppen-Lubinsky Syndrome, a rare condition characterized by severe developmental delay, facial dysmorphism, and intellectual disability. [provided by RefSeq, Apr 2015]

Forensic Context

A study in rats demonstrated that blast wave exposure induced time- and intensity-dependent changes in mRNA expression for vascular wound healing and inflammatory markers, including the KCNJ6 which showed a transient increase at 2 hours after a 5 psi blast, and an earlier, greater, and sustained up-regulation after a 10–11 psi exposure [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001]. A study in mice demonstrated that the KCNJ6 is a differentially wired gene in the prefrontal cortex of selectively bred lines with high versus low risk for voluntary methamphetamine intake, indicating its involvement in brain reward circuitry associated with addiction risk [Hitzemann et al. DOI:10.3390/brainsci9070155].